\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826954506:

Variant ID: vg0826954506 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26954506
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTTTTCTCGATGTGTAGATCGAATTTGAACATGAATTTTGATGGACTAGTAGGTACCATTATACTCTACATTGTCATTTTTTTTTCAGAATTTTT[C/T]
ACAACTATTTGCATCGAATTTAGAAGAAAAAGGTATACAACGGAATATCCCTTCGAGGGACTAGAATTCACTCCCGACAGTAGCAGATTCATTAGTTGCT

Reverse complement sequence

AGCAACTAATGAATCTGCTACTGTCGGGAGTGAATTCTAGTCCCTCGAAGGGATATTCCGTTGTATACCTTTTTCTTCTAAATTCGATGCAAATAGTTGT[G/A]
AAAAATTCTGAAAAAAAAATGACAATGTAGAGTATAATGGTACCTACTAGTCCATCAAAATTCATGTTCAAATTCGATCTACACATCGAGAAAAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.90% 5.60% 0.00% 1.48% NA
All Indica  2759 90.00% 9.60% 0.00% 0.47% NA
All Japonica  1512 99.80% 0.10% 0.00% 0.13% NA
Aus  269 81.00% 0.40% 0.00% 18.59% NA
Indica I  595 88.20% 11.80% 0.00% 0.00% NA
Indica II  465 96.60% 1.70% 0.00% 1.72% NA
Indica III  913 92.20% 7.80% 0.00% 0.00% NA
Indica Intermediate  786 84.70% 14.60% 0.00% 0.64% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 96.70% 1.10% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826954506 C -> T LOC_Os08g42650.1 upstream_gene_variant ; 2038.0bp to feature; MODIFIER silent_mutation Average:49.39; most accessible tissue: Zhenshan97 flower, score: 71.688 N N N N
vg0826954506 C -> T LOC_Os08g42640.1 downstream_gene_variant ; 991.0bp to feature; MODIFIER silent_mutation Average:49.39; most accessible tissue: Zhenshan97 flower, score: 71.688 N N N N
vg0826954506 C -> T LOC_Os08g42640-LOC_Os08g42650 intergenic_region ; MODIFIER silent_mutation Average:49.39; most accessible tissue: Zhenshan97 flower, score: 71.688 N N N N
vg0826954506 C -> DEL N N silent_mutation Average:49.39; most accessible tissue: Zhenshan97 flower, score: 71.688 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826954506 9.84E-07 5.90E-06 mr1412 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826954506 3.50E-07 3.50E-07 mr1412 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826954506 NA 5.25E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826954506 NA 1.64E-07 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826954506 NA 2.51E-10 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826954506 NA 1.23E-08 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251