\
| Variant ID: vg0826954506 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 26954506 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTTTTTTTCTCGATGTGTAGATCGAATTTGAACATGAATTTTGATGGACTAGTAGGTACCATTATACTCTACATTGTCATTTTTTTTTCAGAATTTTT[C/T]
ACAACTATTTGCATCGAATTTAGAAGAAAAAGGTATACAACGGAATATCCCTTCGAGGGACTAGAATTCACTCCCGACAGTAGCAGATTCATTAGTTGCT
AGCAACTAATGAATCTGCTACTGTCGGGAGTGAATTCTAGTCCCTCGAAGGGATATTCCGTTGTATACCTTTTTCTTCTAAATTCGATGCAAATAGTTGT[G/A]
AAAAATTCTGAAAAAAAAATGACAATGTAGAGTATAATGGTACCTACTAGTCCATCAAAATTCATGTTCAAATTCGATCTACACATCGAGAAAAAAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 5.60% | 0.00% | 1.48% | NA |
| All Indica | 2759 | 90.00% | 9.60% | 0.00% | 0.47% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.00% | 0.13% | NA |
| Aus | 269 | 81.00% | 0.40% | 0.00% | 18.59% | NA |
| Indica I | 595 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.60% | 1.70% | 0.00% | 1.72% | NA |
| Indica III | 913 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.70% | 14.60% | 0.00% | 0.64% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 96.70% | 1.10% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0826954506 | C -> T | LOC_Os08g42650.1 | upstream_gene_variant ; 2038.0bp to feature; MODIFIER | silent_mutation | Average:49.39; most accessible tissue: Zhenshan97 flower, score: 71.688 | N | N | N | N |
| vg0826954506 | C -> T | LOC_Os08g42640.1 | downstream_gene_variant ; 991.0bp to feature; MODIFIER | silent_mutation | Average:49.39; most accessible tissue: Zhenshan97 flower, score: 71.688 | N | N | N | N |
| vg0826954506 | C -> T | LOC_Os08g42640-LOC_Os08g42650 | intergenic_region ; MODIFIER | silent_mutation | Average:49.39; most accessible tissue: Zhenshan97 flower, score: 71.688 | N | N | N | N |
| vg0826954506 | C -> DEL | N | N | silent_mutation | Average:49.39; most accessible tissue: Zhenshan97 flower, score: 71.688 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0826954506 | 9.84E-07 | 5.90E-06 | mr1412 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826954506 | 3.50E-07 | 3.50E-07 | mr1412 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826954506 | NA | 5.25E-06 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826954506 | NA | 1.64E-07 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826954506 | NA | 2.51E-10 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0826954506 | NA | 1.23E-08 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |