Variant ID: vg0826953770 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 26953770 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGCGCTGAATATGACATGGCGCTGAGGTGTCTAAGTTCAGCGCCAGGTGATTTGGCGCTGACCAAAAGAGTCATTTTTGAAATAAGTTTTGGCAGCGGTT[T/C]
ATTTGTAAAAAAAGTTTTTGCAAAGGGTCAAATTGTGAAAATTTCAGAAATAACTACATACTAGTTGTGTGGCACCTTTTTGGGGGAGCTCGACATGTCA
TGACATGTCGAGCTCCCCCAAAAAGGTGCCACACAACTAGTATGTAGTTATTTCTGAAATTTTCACAATTTGACCCTTTGCAAAAACTTTTTTTACAAAT[A/G]
AACCGCTGCCAAAACTTATTTCAAAAATGACTCTTTTGGTCAGCGCCAAATCACCTGGCGCTGAACTTAGACACCTCAGCGCCATGTCATATTCAGCGCC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 71.40% | 27.10% | 0.06% | 1.44% | NA |
All Indica | 2759 | 98.40% | 1.10% | 0.00% | 0.47% | NA |
All Japonica | 1512 | 24.00% | 75.80% | 0.07% | 0.13% | NA |
Aus | 269 | 80.70% | 0.70% | 0.74% | 17.84% | NA |
Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 97.80% | 0.40% | 0.00% | 1.72% | NA |
Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 96.90% | 2.40% | 0.00% | 0.64% | NA |
Temperate Japonica | 767 | 9.10% | 90.90% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 39.30% | 60.10% | 0.20% | 0.40% | NA |
Japonica Intermediate | 241 | 39.40% | 60.60% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 18.80% | 78.10% | 0.00% | 3.12% | NA |
Intermediate | 90 | 70.00% | 27.80% | 0.00% | 2.22% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0826953770 | T -> C | LOC_Os08g42650.1 | upstream_gene_variant ; 2774.0bp to feature; MODIFIER | silent_mutation | Average:52.973; most accessible tissue: Callus, score: 77.517 | N | N | N | N |
vg0826953770 | T -> C | LOC_Os08g42640.1 | downstream_gene_variant ; 255.0bp to feature; MODIFIER | silent_mutation | Average:52.973; most accessible tissue: Callus, score: 77.517 | N | N | N | N |
vg0826953770 | T -> C | LOC_Os08g42640-LOC_Os08g42650 | intergenic_region ; MODIFIER | silent_mutation | Average:52.973; most accessible tissue: Callus, score: 77.517 | N | N | N | N |
vg0826953770 | T -> DEL | N | N | silent_mutation | Average:52.973; most accessible tissue: Callus, score: 77.517 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0826953770 | NA | 4.74E-17 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0826953770 | NA | 1.49E-27 | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0826953770 | NA | 1.65E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0826953770 | NA | 7.87E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0826953770 | 5.42E-07 | 3.64E-42 | mr1601 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0826953770 | NA | 2.52E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0826953770 | NA | 2.06E-08 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |