\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826647662:

Variant ID: vg0826647662 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26647662
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.51, G: 0.49, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


CAATTTGACCCCCTTGGTGGTTTTGGAAAGTGGTTTTGCTGATGTGGCGCACACGTGGCAGTATTGACTTAGTCTTCGTCCCACGTGGCATTGACGTGGC[A/G]
CTGATGTGGCATTAAAATTTAAAAATATAAGCAGGGTCCATTTGTCATTCACACAAAAATAATTGTAGGCCCCACTGACATGTGGGTCCCACATGTCATC

Reverse complement sequence

GATGACATGTGGGACCCACATGTCAGTGGGGCCTACAATTATTTTTGTGTGAATGACAAATGGACCCTGCTTATATTTTTAAATTTTAATGCCACATCAG[T/C]
GCCACGTCAATGCCACGTGGGACGAAGACTAAGTCAATACTGCCACGTGTGCGCCACATCAGCAAAACCACTTTCCAAAACCACCAAGGGGGTCAAATTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.40% 0.10% 25.58% 29.83% NA
All Indica  2759 20.70% 0.30% 41.21% 37.88% NA
All Japonica  1512 82.90% 0.00% 3.44% 13.69% NA
Aus  269 52.40% 0.00% 1.49% 46.10% NA
Indica I  595 31.10% 0.20% 30.92% 37.82% NA
Indica II  465 4.10% 0.60% 70.54% 24.73% NA
Indica III  913 23.20% 0.00% 28.81% 47.97% NA
Indica Intermediate  786 19.60% 0.40% 46.06% 33.97% NA
Temperate Japonica  767 95.00% 0.00% 0.13% 4.82% NA
Tropical Japonica  504 73.40% 0.00% 6.75% 19.84% NA
Japonica Intermediate  241 63.90% 0.00% 7.05% 29.05% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 48.90% 0.00% 17.78% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826647662 A -> G LOC_Os08g42160.1 upstream_gene_variant ; 1916.0bp to feature; MODIFIER silent_mutation Average:27.796; most accessible tissue: Minghui63 root, score: 87.044 N N N N
vg0826647662 A -> G LOC_Os08g42189.2 upstream_gene_variant ; 4452.0bp to feature; MODIFIER silent_mutation Average:27.796; most accessible tissue: Minghui63 root, score: 87.044 N N N N
vg0826647662 A -> G LOC_Os08g42189.3 upstream_gene_variant ; 4452.0bp to feature; MODIFIER silent_mutation Average:27.796; most accessible tissue: Minghui63 root, score: 87.044 N N N N
vg0826647662 A -> G LOC_Os08g42170.1 downstream_gene_variant ; 408.0bp to feature; MODIFIER silent_mutation Average:27.796; most accessible tissue: Minghui63 root, score: 87.044 N N N N
vg0826647662 A -> G LOC_Os08g42180.1 downstream_gene_variant ; 181.0bp to feature; MODIFIER silent_mutation Average:27.796; most accessible tissue: Minghui63 root, score: 87.044 N N N N
vg0826647662 A -> G LOC_Os08g42170-LOC_Os08g42180 intergenic_region ; MODIFIER silent_mutation Average:27.796; most accessible tissue: Minghui63 root, score: 87.044 N N N N
vg0826647662 A -> DEL N N silent_mutation Average:27.796; most accessible tissue: Minghui63 root, score: 87.044 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826647662 NA 1.56E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 2.24E-06 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 2.67E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 1.06E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 2.18E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 1.66E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 7.71E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 4.44E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 2.25E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 9.00E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 1.43E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 2.12E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 1.40E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 6.63E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 1.53E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 1.71E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 5.97E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 4.56E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 7.21E-07 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 3.33E-06 1.63E-07 mr1445_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 6.23E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 4.75E-07 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 1.59E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 1.10E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 1.36E-06 1.36E-06 mr1674_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 2.50E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 9.11E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 1.31E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 2.26E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 5.62E-06 6.99E-06 mr1851_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 5.52E-06 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826647662 NA 2.01E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251