\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826517634:

Variant ID: vg0826517634 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26517634
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAATTATACTCCCTTCGTCTAAGAAAACCAATTTAGTATTGGATGGGGTACTTCATAGTACAACGAATTTAAACAGGAGTTTGTCCAGTTTCGTTATCG[C/T]
AGAAAATACCTCATCCAATAATAGGTTAATTTTTTTTTGACAGAAGGAGTACTCAGTTACAAAGCACTCATATACTCGTTTACATAGCACTTACATTTAA

Reverse complement sequence

TTAAATGTAAGTGCTATGTAAACGAGTATATGAGTGCTTTGTAACTGAGTACTCCTTCTGTCAAAAAAAAATTAACCTATTATTGGATGAGGTATTTTCT[G/A]
CGATAACGAAACTGGACAAACTCCTGTTTAAATTCGTTGTACTATGAAGTACCCCATCCAATACTAAATTGGTTTTCTTAGACGAAGGGAGTATAATTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 29.90% 0.02% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 17.70% 82.30% 0.00% 0.00% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 5.30% 94.70% 0.00% 0.00% NA
Tropical Japonica  504 27.00% 73.00% 0.00% 0.00% NA
Japonica Intermediate  241 37.80% 62.20% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 58.90% 40.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826517634 C -> T LOC_Os08g41960.1 upstream_gene_variant ; 1342.0bp to feature; MODIFIER silent_mutation Average:31.913; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0826517634 C -> T LOC_Os08g41950-LOC_Os08g41960 intergenic_region ; MODIFIER silent_mutation Average:31.913; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826517634 NA 1.02E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 NA 1.16E-32 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 NA 1.65E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 NA 3.63E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 NA 3.33E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 NA 2.30E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 9.77E-06 9.77E-06 mr1413 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 1.22E-06 NA mr1415 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 NA 2.30E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 1.22E-06 NA mr1567 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 NA 3.27E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 NA 7.45E-58 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 NA 1.18E-36 mr1882 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 NA 1.49E-23 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 NA 3.02E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826517634 NA 5.19E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251