\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826323144:

Variant ID: vg0826323144 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26323144
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGGACTTTGTAGGAAAAATTCCTATAAGAATGAAATCCTCTAAAATTCCTATGAATTTCCTTTGAATCAAAGGGGCCTTAATTTTATATCGCCAAGAA[C/T]
ATGTATATAAGTTTTATACACAGATTTTTTTTTTTCATTTGCAAATAGTATATTGTTTCTCTTTTTTCCTTCGATATGATAGGGCTGCATGTTCCCTCTC

Reverse complement sequence

GAGAGGGAACATGCAGCCCTATCATATCGAAGGAAAAAAGAGAAACAATATACTATTTGCAAATGAAAAAAAAAAATCTGTGTATAAAACTTATATACAT[G/A]
TTCTTGGCGATATAAAATTAAGGCCCCTTTGATTCAAAGGAAATTCATAGGAATTTTAGAGGATTTCATTCTTATAGGAATTTTTCCTACAAAGTCCTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 11.90% 15.21% 3.72% NA
All Indica  2759 49.00% 19.90% 25.08% 5.94% NA
All Japonica  1512 98.90% 0.10% 0.60% 0.33% NA
Aus  269 96.70% 0.00% 2.23% 1.12% NA
Indica I  595 56.30% 9.10% 31.26% 3.36% NA
Indica II  465 34.20% 33.80% 26.02% 6.02% NA
Indica III  913 56.10% 17.90% 19.06% 7.01% NA
Indica Intermediate  786 44.10% 22.40% 26.84% 6.62% NA
Temperate Japonica  767 98.70% 0.10% 0.78% 0.39% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 0.00% 1.24% 0.83% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 71.10% 11.10% 13.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826323144 C -> T LOC_Os08g41700.1 upstream_gene_variant ; 619.0bp to feature; MODIFIER silent_mutation Average:31.272; most accessible tissue: Minghui63 flower, score: 44.843 N N N N
vg0826323144 C -> T LOC_Os08g41710.1 upstream_gene_variant ; 1852.0bp to feature; MODIFIER silent_mutation Average:31.272; most accessible tissue: Minghui63 flower, score: 44.843 N N N N
vg0826323144 C -> T LOC_Os08g41700-LOC_Os08g41710 intergenic_region ; MODIFIER silent_mutation Average:31.272; most accessible tissue: Minghui63 flower, score: 44.843 N N N N
vg0826323144 C -> DEL N N silent_mutation Average:31.272; most accessible tissue: Minghui63 flower, score: 44.843 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826323144 NA 1.07E-06 mr1432 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826323144 NA 3.39E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826323144 NA 1.73E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251