\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0826150537:

Variant ID: vg0826150537 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 26150537
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.39, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GATCACATTGCAGGTTAACAAATGGTTTTGCATGTTTACTTCTGAGTGCAAAGGCTGACATGCATATAAATTGTAAGTTGTTGGGTAGACACAGAAAAGT[T/C]
CAGGAGTTTTCCAGCTAGCTTCATAAGATGGTGGTCTAGACGATATCACTTCTTCTAATTATTTGATATTAGGTCCTTTCCTAACGTTCGCGTTTTTTTT

Reverse complement sequence

AAAAAAAACGCGAACGTTAGGAAAGGACCTAATATCAAATAATTAGAAGAAGTGATATCGTCTAGACCACCATCTTATGAAGCTAGCTGGAAAACTCCTG[A/G]
ACTTTTCTGTGTCTACCCAACAACTTACAATTTATATGCATGTCAGCCTTTGCACTCAGAAGTAAACATGCAAAACCATTTGTTAACCTGCAATGTGATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 38.40% 0.34% 0.15% NA
All Indica  2759 41.90% 57.30% 0.54% 0.25% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 35.70% 64.30% 0.00% 0.00% NA
Indica I  595 46.90% 52.60% 0.50% 0.00% NA
Indica II  465 64.30% 34.80% 0.65% 0.22% NA
Indica III  913 26.50% 72.40% 0.66% 0.44% NA
Indica Intermediate  786 42.60% 56.70% 0.38% 0.25% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0826150537 T -> C LOC_Os08g41400.1 upstream_gene_variant ; 2657.0bp to feature; MODIFIER silent_mutation Average:57.693; most accessible tissue: Callus, score: 90.108 N N N N
vg0826150537 T -> C LOC_Os08g41420.1 downstream_gene_variant ; 3480.0bp to feature; MODIFIER silent_mutation Average:57.693; most accessible tissue: Callus, score: 90.108 N N N N
vg0826150537 T -> C LOC_Os08g41410.1 intron_variant ; MODIFIER silent_mutation Average:57.693; most accessible tissue: Callus, score: 90.108 N N N N
vg0826150537 T -> DEL N N silent_mutation Average:57.693; most accessible tissue: Callus, score: 90.108 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0826150537 5.39E-06 5.39E-06 mr1046 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 3.56E-06 3.56E-06 mr1048 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 NA 2.65E-06 mr1264 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 NA 7.23E-06 mr1283 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 4.19E-06 7.20E-07 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 NA 2.35E-12 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 NA 2.20E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 NA 2.02E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 NA 5.77E-06 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 6.10E-06 1.07E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 NA 2.10E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 4.89E-06 4.88E-06 mr1569 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 NA 1.13E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 4.22E-06 NA mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 1.27E-07 2.69E-08 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 NA 9.33E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 NA 4.75E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0826150537 9.64E-07 9.64E-07 mr1953 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251