Variant ID: vg0825887514 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 25887514 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCTCAATGACAATAAAAAAGGGAGGCAGCGGGCGAGCCGCAGAGGAGTACGATGGTAAAGCTGCTGACGGTTTGGCGAGACTTCTAGAAAGTAAAAAAAT[G/A]
AACCCAAACGATAATTATGTTCGATTTTTAAAATCTCAATGACAACAAAGAGAAGAGATAGTGGACGGGCCGTAGAGGAGTATAATGGCAACGTTTGACA
TGTCAAACGTTGCCATTATACTCCTCTACGGCCCGTCCACTATCTCTTCTCTTTGTTGTCATTGAGATTTTAAAAATCGAACATAATTATCGTTTGGGTT[C/T]
ATTTTTTTACTTTCTAGAAGTCTCGCCAAACCGTCAGCAGCTTTACCATCGTACTCCTCTGCGGCTCGCCCGCTGCCTCCCTTTTTTATTGTCATTGAGA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 54.10% | 45.40% | 0.06% | 0.40% | NA |
All Indica | 2759 | 90.10% | 9.20% | 0.07% | 0.65% | NA |
All Japonica | 1512 | 1.90% | 98.00% | 0.00% | 0.07% | NA |
Aus | 269 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 97.30% | 2.20% | 0.17% | 0.34% | NA |
Indica II | 465 | 96.10% | 2.60% | 0.00% | 1.29% | NA |
Indica III | 913 | 84.90% | 14.70% | 0.00% | 0.44% | NA |
Indica Intermediate | 786 | 87.00% | 12.10% | 0.13% | 0.76% | NA |
Temperate Japonica | 767 | 2.30% | 97.70% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 1.00% | 98.80% | 0.00% | 0.20% | NA |
Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 41.10% | 57.80% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0825887514 | G -> A | LOC_Os08g40919.1 | upstream_gene_variant ; 1980.0bp to feature; MODIFIER | silent_mutation | Average:56.254; most accessible tissue: Minghui63 flower, score: 73.972 | N | N | N | N |
vg0825887514 | G -> A | LOC_Os08g40919.2 | upstream_gene_variant ; 1980.0bp to feature; MODIFIER | silent_mutation | Average:56.254; most accessible tissue: Minghui63 flower, score: 73.972 | N | N | N | N |
vg0825887514 | G -> A | LOC_Os08g40910.1 | downstream_gene_variant ; 716.0bp to feature; MODIFIER | silent_mutation | Average:56.254; most accessible tissue: Minghui63 flower, score: 73.972 | N | N | N | N |
vg0825887514 | G -> A | LOC_Os08g40930.1 | downstream_gene_variant ; 4877.0bp to feature; MODIFIER | silent_mutation | Average:56.254; most accessible tissue: Minghui63 flower, score: 73.972 | N | N | N | N |
vg0825887514 | G -> A | LOC_Os08g40900-LOC_Os08g40910 | intergenic_region ; MODIFIER | silent_mutation | Average:56.254; most accessible tissue: Minghui63 flower, score: 73.972 | N | N | N | N |
vg0825887514 | G -> DEL | N | N | silent_mutation | Average:56.254; most accessible tissue: Minghui63 flower, score: 73.972 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0825887514 | NA | 1.41E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825887514 | NA | 6.64E-13 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825887514 | NA | 1.92E-12 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825887514 | NA | 8.79E-20 | mr1183_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825887514 | 3.25E-06 | NA | mr1183_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825887514 | NA | 4.26E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825887514 | NA | 8.41E-08 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825887514 | NA | 4.46E-26 | mr1943_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |