Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0825887514:

Variant ID: vg0825887514 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25887514
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCAATGACAATAAAAAAGGGAGGCAGCGGGCGAGCCGCAGAGGAGTACGATGGTAAAGCTGCTGACGGTTTGGCGAGACTTCTAGAAAGTAAAAAAAT[G/A]
AACCCAAACGATAATTATGTTCGATTTTTAAAATCTCAATGACAACAAAGAGAAGAGATAGTGGACGGGCCGTAGAGGAGTATAATGGCAACGTTTGACA

Reverse complement sequence

TGTCAAACGTTGCCATTATACTCCTCTACGGCCCGTCCACTATCTCTTCTCTTTGTTGTCATTGAGATTTTAAAAATCGAACATAATTATCGTTTGGGTT[C/T]
ATTTTTTTACTTTCTAGAAGTCTCGCCAAACCGTCAGCAGCTTTACCATCGTACTCCTCTGCGGCTCGCCCGCTGCCTCCCTTTTTTATTGTCATTGAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 45.40% 0.06% 0.40% NA
All Indica  2759 90.10% 9.20% 0.07% 0.65% NA
All Japonica  1512 1.90% 98.00% 0.00% 0.07% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 97.30% 2.20% 0.17% 0.34% NA
Indica II  465 96.10% 2.60% 0.00% 1.29% NA
Indica III  913 84.90% 14.70% 0.00% 0.44% NA
Indica Intermediate  786 87.00% 12.10% 0.13% 0.76% NA
Temperate Japonica  767 2.30% 97.70% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.80% 0.00% 0.20% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 41.10% 57.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825887514 G -> A LOC_Os08g40919.1 upstream_gene_variant ; 1980.0bp to feature; MODIFIER silent_mutation Average:56.254; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg0825887514 G -> A LOC_Os08g40919.2 upstream_gene_variant ; 1980.0bp to feature; MODIFIER silent_mutation Average:56.254; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg0825887514 G -> A LOC_Os08g40910.1 downstream_gene_variant ; 716.0bp to feature; MODIFIER silent_mutation Average:56.254; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg0825887514 G -> A LOC_Os08g40930.1 downstream_gene_variant ; 4877.0bp to feature; MODIFIER silent_mutation Average:56.254; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg0825887514 G -> A LOC_Os08g40900-LOC_Os08g40910 intergenic_region ; MODIFIER silent_mutation Average:56.254; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg0825887514 G -> DEL N N silent_mutation Average:56.254; most accessible tissue: Minghui63 flower, score: 73.972 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825887514 NA 1.41E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825887514 NA 6.64E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825887514 NA 1.92E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825887514 NA 8.79E-20 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825887514 3.25E-06 NA mr1183_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825887514 NA 4.26E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825887514 NA 8.41E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825887514 NA 4.46E-26 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251