Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0825703185:

Variant ID: vg0825703185 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25703185
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

CTGATAGCCAATACCTGATCCAGGGCAATAGTGGCAGATGATGAACTTTGGACAGTGTCAATGAAGAATGCTGAAGGATGCACTCGAATGGTAATGCGTC[A/G]
ATTAAGCAATTAGACAACACAAAAGATCGAATTCAGGCCCTATGGCTATCAGACATCAATAGGATAAAAATGATAATAAAAACTTCACACTCATTGCTAT

Reverse complement sequence

ATAGCAATGAGTGTGAAGTTTTTATTATCATTTTTATCCTATTGATGTCTGATAGCCATAGGGCCTGAATTCGATCTTTTGTGTTGTCTAATTGCTTAAT[T/C]
GACGCATTACCATTCGAGTGCATCCTTCAGCATTCTTCATTGACACTGTCCAAAGTTCATCATCTGCCACTATTGCCCTGGATCAGGTATTGGCTATCAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.10%	7.10%	0.78%	0.00%	NA
All Indica	2759	99.40%	0.10%	0.47%	0.00%	NA
All Japonica	1512	77.10%	21.50%	1.46%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	0.00%	1.18%	0.00%	NA
Indica II	465	99.10%	0.00%	0.86%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.30%	0.25%	0.00%	NA
Temperate Japonica	767	95.20%	4.60%	0.26%	0.00%	NA
Tropical Japonica	504	48.40%	48.60%	2.98%	0.00%	NA
Japonica Intermediate	241	79.30%	18.70%	2.07%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	6.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825703185	A -> G	LOC_Os08g40600.1	upstream_gene_variant ; 1562.0bp to feature; MODIFIER	silent_mutation	Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N
vg0825703185	A -> G	LOC_Os08g40615.1	upstream_gene_variant ; 4509.0bp to feature; MODIFIER	silent_mutation	Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N
vg0825703185	A -> G	LOC_Os08g40590.2	downstream_gene_variant ; 3546.0bp to feature; MODIFIER	silent_mutation	Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N
vg0825703185	A -> G	LOC_Os08g40590.1	downstream_gene_variant ; 3546.0bp to feature; MODIFIER	silent_mutation	Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N
vg0825703185	A -> G	LOC_Os08g40610.1	intron_variant ; MODIFIER	silent_mutation	Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825703185	NA	7.93E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185	NA	8.30E-14	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185	NA	8.77E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185	9.16E-06	1.46E-33	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185	NA	7.41E-17	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185	2.66E-07	3.05E-17	mr1871	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185	NA	1.13E-07	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185	NA	2.19E-12	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185	NA	1.98E-14	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185	NA	1.15E-09	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251