\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825703185:

Variant ID: vg0825703185 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25703185
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


CTGATAGCCAATACCTGATCCAGGGCAATAGTGGCAGATGATGAACTTTGGACAGTGTCAATGAAGAATGCTGAAGGATGCACTCGAATGGTAATGCGTC[A/G]
ATTAAGCAATTAGACAACACAAAAGATCGAATTCAGGCCCTATGGCTATCAGACATCAATAGGATAAAAATGATAATAAAAACTTCACACTCATTGCTAT

Reverse complement sequence

ATAGCAATGAGTGTGAAGTTTTTATTATCATTTTTATCCTATTGATGTCTGATAGCCATAGGGCCTGAATTCGATCTTTTGTGTTGTCTAATTGCTTAAT[T/C]
GACGCATTACCATTCGAGTGCATCCTTCAGCATTCTTCATTGACACTGTCCAAAGTTCATCATCTGCCACTATTGCCCTGGATCAGGTATTGGCTATCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 7.10% 0.78% 0.00% NA
All Indica  2759 99.40% 0.10% 0.47% 0.00% NA
All Japonica  1512 77.10% 21.50% 1.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 0.00% 1.18% 0.00% NA
Indica II  465 99.10% 0.00% 0.86% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.30% 0.25% 0.00% NA
Temperate Japonica  767 95.20% 4.60% 0.26% 0.00% NA
Tropical Japonica  504 48.40% 48.60% 2.98% 0.00% NA
Japonica Intermediate  241 79.30% 18.70% 2.07% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825703185 A -> G LOC_Os08g40600.1 upstream_gene_variant ; 1562.0bp to feature; MODIFIER silent_mutation Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N
vg0825703185 A -> G LOC_Os08g40615.1 upstream_gene_variant ; 4509.0bp to feature; MODIFIER silent_mutation Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N
vg0825703185 A -> G LOC_Os08g40590.2 downstream_gene_variant ; 3546.0bp to feature; MODIFIER silent_mutation Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N
vg0825703185 A -> G LOC_Os08g40590.1 downstream_gene_variant ; 3546.0bp to feature; MODIFIER silent_mutation Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N
vg0825703185 A -> G LOC_Os08g40610.1 intron_variant ; MODIFIER silent_mutation Average:70.003; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825703185 NA 7.93E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185 NA 8.30E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185 NA 8.77E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185 9.16E-06 1.46E-33 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185 NA 7.41E-17 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185 2.66E-07 3.05E-17 mr1871 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185 NA 1.13E-07 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185 NA 2.19E-12 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185 NA 1.98E-14 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825703185 NA 1.15E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251