Variant ID: vg0825510141 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 25510141 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 65. )
TCCTAAGTGCGCCGTGCGCGGGAACACGCGCCGCCGCTGACGCCGCCGTCCCCCATCCACCAGAGCGCCGGCAGCCCGCTCGCCTTCCCCTCTTCCTCCT[C/T]
TCGGTTCTCTGTGAAACAGAGAGAAGAGAGAAGACGGGAGGAAGAAGGAGGAAAAGAAAAAGAAACGGAAAGGCTATATGACTGTCGCATGTTTTTGTTG
CAACAAAAACATGCGACAGTCATATAGCCTTTCCGTTTCTTTTTCTTTTCCTCCTTCTTCCTCCCGTCTTCTCTCTTCTCTCTGTTTCACAGAGAACCGA[G/A]
AGGAGGAAGAGGGGAAGGCGAGCGGGCTGCCGGCGCTCTGGTGGATGGGGGACGGCGGCGTCAGCGGCGGCGCGTGTTCCCGCGCACGGCGCACTTAGGA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 45.60% | 6.50% | 12.19% | 35.72% | NA |
All Indica | 2759 | 19.90% | 11.00% | 14.14% | 54.91% | NA |
All Japonica | 1512 | 97.70% | 0.00% | 0.93% | 1.39% | NA |
Aus | 269 | 2.20% | 0.00% | 57.62% | 40.15% | NA |
Indica I | 595 | 42.90% | 5.70% | 7.23% | 44.20% | NA |
Indica II | 465 | 11.60% | 21.10% | 16.56% | 50.75% | NA |
Indica III | 913 | 10.20% | 9.50% | 17.85% | 62.43% | NA |
Indica Intermediate | 786 | 18.80% | 10.80% | 13.61% | 56.74% | NA |
Temperate Japonica | 767 | 98.00% | 0.00% | 0.26% | 1.69% | NA |
Tropical Japonica | 504 | 99.00% | 0.00% | 0.60% | 0.40% | NA |
Japonica Intermediate | 241 | 93.80% | 0.00% | 3.73% | 2.49% | NA |
VI/Aromatic | 96 | 81.20% | 0.00% | 8.33% | 10.42% | NA |
Intermediate | 90 | 50.00% | 2.20% | 10.00% | 37.78% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0825510141 | C -> T | LOC_Os08g40290.1 | 5_prime_UTR_variant ; 314.0bp to feature; MODIFIER | silent_mutation | Average:42.985; most accessible tissue: Zhenshan97 flower, score: 82.834 | N | N | N | N |
vg0825510141 | C -> DEL | N | N | silent_mutation | Average:42.985; most accessible tissue: Zhenshan97 flower, score: 82.834 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0825510141 | NA | 1.12E-06 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825510141 | 1.30E-06 | NA | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825510141 | 1.30E-10 | 1.63E-15 | mr1874 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825510141 | NA | 4.94E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825510141 | NA | 4.00E-10 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825510141 | NA | 9.91E-08 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825510141 | 2.92E-06 | NA | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0825510141 | 1.43E-08 | 3.18E-15 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |