\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825425930:

Variant ID: vg0825425930 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25425930
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GATAGGTATCATATTTCTTAAACTGTAACACCTATTAGTGCTTGGCGTACTTAGAGCAAGTTTAATAGTATAGACAACTACTAGCTCCAAAACATTTATA[A/G]
TCAATTTAGTCAATTCTTACCATAATTACCTATAAGAGCAGTTACAATACCAGACTACTCTCTCCGTCCTATTTTAAGTGCAGCCATGATTTTCCGTGCA

Reverse complement sequence

TGCACGGAAAATCATGGCTGCACTTAAAATAGGACGGAGAGAGTAGTCTGGTATTGTAACTGCTCTTATAGGTAATTATGGTAAGAATTGACTAAATTGA[T/C]
TATAAATGTTTTGGAGCTAGTAGTTGTCTATACTATTAAACTTGCTCTAAGTACGCCAAGCACTAATAGGTGTTACAGTTTAAGAAATATGATACCTATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 7.10% 2.26% 0.00% NA
All Indica  2759 99.50% 0.00% 0.43% 0.00% NA
All Japonica  1512 72.40% 21.40% 6.22% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 98.80% 0.20% 1.01% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.00% 0.51% 0.00% NA
Temperate Japonica  767 49.20% 40.30% 10.56% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 89.20% 5.80% 4.98% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825425930 A -> G LOC_Os08g40180.1 upstream_gene_variant ; 721.0bp to feature; MODIFIER silent_mutation Average:74.113; most accessible tissue: Minghui63 flag leaf, score: 99.866 N N N N
vg0825425930 A -> G LOC_Os08g40170.1 downstream_gene_variant ; 4103.0bp to feature; MODIFIER silent_mutation Average:74.113; most accessible tissue: Minghui63 flag leaf, score: 99.866 N N N N
vg0825425930 A -> G LOC_Os08g40170.2 downstream_gene_variant ; 4103.0bp to feature; MODIFIER silent_mutation Average:74.113; most accessible tissue: Minghui63 flag leaf, score: 99.866 N N N N
vg0825425930 A -> G LOC_Os08g40170-LOC_Os08g40180 intergenic_region ; MODIFIER silent_mutation Average:74.113; most accessible tissue: Minghui63 flag leaf, score: 99.866 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825425930 NA 1.54E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 2.37E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 7.39E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 1.58E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 2.30E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 5.15E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 1.13E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 1.28E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 5.17E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 1.68E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 3.35E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 4.40E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 1.12E-07 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 4.72E-08 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 5.38E-06 8.82E-08 mr1910 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 1.33E-10 mr1977 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 1.05E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 4.46E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930 NA 1.60E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251