Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825425930:

Variant ID: vg0825425930 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25425930
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

GATAGGTATCATATTTCTTAAACTGTAACACCTATTAGTGCTTGGCGTACTTAGAGCAAGTTTAATAGTATAGACAACTACTAGCTCCAAAACATTTATA[A/G]
TCAATTTAGTCAATTCTTACCATAATTACCTATAAGAGCAGTTACAATACCAGACTACTCTCTCCGTCCTATTTTAAGTGCAGCCATGATTTTCCGTGCA

Reverse complement sequence

TGCACGGAAAATCATGGCTGCACTTAAAATAGGACGGAGAGAGTAGTCTGGTATTGTAACTGCTCTTATAGGTAATTATGGTAAGAATTGACTAAATTGA[T/C]
TATAAATGTTTTGGAGCTAGTAGTTGTCTATACTATTAAACTTGCTCTAAGTACGCCAAGCACTAATAGGTGTTACAGTTTAAGAAATATGATACCTATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	7.10%	2.26%	0.00%	NA
All Indica	2759	99.50%	0.00%	0.43%	0.00%	NA
All Japonica	1512	72.40%	21.40%	6.22%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	98.80%	0.20%	1.01%	0.00%	NA
Indica II	465	99.60%	0.00%	0.43%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.00%	0.51%	0.00%	NA
Temperate Japonica	767	49.20%	40.30%	10.56%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	89.20%	5.80%	4.98%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825425930	A -> G	LOC_Os08g40180.1	upstream_gene_variant ; 721.0bp to feature; MODIFIER	silent_mutation	Average:74.113; most accessible tissue: Minghui63 flag leaf, score: 99.866	N	N	N	N
vg0825425930	A -> G	LOC_Os08g40170.1	downstream_gene_variant ; 4103.0bp to feature; MODIFIER	silent_mutation	Average:74.113; most accessible tissue: Minghui63 flag leaf, score: 99.866	N	N	N	N
vg0825425930	A -> G	LOC_Os08g40170.2	downstream_gene_variant ; 4103.0bp to feature; MODIFIER	silent_mutation	Average:74.113; most accessible tissue: Minghui63 flag leaf, score: 99.866	N	N	N	N
vg0825425930	A -> G	LOC_Os08g40170-LOC_Os08g40180	intergenic_region ; MODIFIER	silent_mutation	Average:74.113; most accessible tissue: Minghui63 flag leaf, score: 99.866	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825425930	NA	1.54E-06	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	2.37E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	7.39E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	1.58E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	2.30E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	5.15E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	1.13E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	1.28E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	5.17E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	1.68E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	3.35E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	4.40E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	1.12E-07	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	4.72E-08	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	5.38E-06	8.82E-08	mr1910	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	1.33E-10	mr1977	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	1.05E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	4.46E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825425930	NA	1.60E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251