\
| Variant ID: vg0825263980 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25263980 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTACCACCAACCATCACCACTATTCTATATGCACGGGAATATAGTAGGACTCTTAAGGGTGTGTTTAGTTCACGCAAAAAATGGAAGTTTGGTTGAAATT[A/G]
GAACGATTTGACGAAAAAGTTAGAAGTTTATGTGTGTAGGAAAGTTTTGATGTGATGGAAAAGTTGAAAGTTTAAAGAAAAATTTTAGAACTAAACTCGG
CCGAGTTTAGTTCTAAAATTTTTCTTTAAACTTTCAACTTTTCCATCACATCAAAACTTTCCTACACACATAAACTTCTAACTTTTTCGTCAAATCGTTC[T/C]
AATTTCAACCAAACTTCCATTTTTTGCGTGAACTAAACACACCCTTAAGAGTCCTACTATATTCCCGTGCATATAGAATAGTGGTGATGGTTGGTGGTAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.00% | 13.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 85.80% | 14.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 6.70% | 93.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.50% | 21.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 79.50% | 20.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825263980 | A -> G | LOC_Os08g39870.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.121; most accessible tissue: Callus, score: 72.882 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825263980 | NA | 2.58E-10 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0825263980 | 6.96E-13 | 2.38E-25 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825263980 | 2.59E-10 | 2.31E-10 | mr1874 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825263980 | 1.73E-06 | 2.14E-26 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825263980 | 5.46E-08 | 1.29E-09 | mr1874_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |