\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825180746:

Variant ID: vg0825180746 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25180746
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATATTTCCAAAATTTTCGGATATATCTGAAAATTTTCGAAGTCAGCACAAATAGCAAAGTAAATCCTAGATCTAGTTGCCTACAACAAGAATATGCTAG[T/C]
ACAAATAGCAACTAGACCTATAGCGGCTCGAACAAGCAAAGCTAGTGGAGAGGGAGGAAGTAAAGTCACCAAAGATGAAGCTCACGAGGTTGTTCCCGAA

Reverse complement sequence

TTCGGGAACAACCTCGTGAGCTTCATCTTTGGTGACTTTACTTCCTCCCTCTCCACTAGCTTTGCTTGTTCGAGCCGCTATAGGTCTAGTTGCTATTTGT[A/G]
CTAGCATATTCTTGTTGTAGGCAACTAGATCTAGGATTTACTTTGCTATTTGTGCTGACTTCGAAAATTTTCAGATATATCCGAAAATTTTGGAAATATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 21.80% 3.43% 0.30% NA
All Indica  2759 66.10% 27.70% 5.65% 0.51% NA
All Japonica  1512 99.70% 0.20% 0.13% 0.00% NA
Aus  269 8.60% 91.40% 0.00% 0.00% NA
Indica I  595 82.50% 2.50% 13.61% 1.34% NA
Indica II  465 78.10% 19.80% 2.15% 0.00% NA
Indica III  913 49.60% 46.20% 3.61% 0.55% NA
Indica Intermediate  786 65.90% 29.90% 4.07% 0.13% NA
Temperate Japonica  767 99.60% 0.10% 0.26% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 83.30% 12.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825180746 T -> C LOC_Os08g39760.1 upstream_gene_variant ; 235.0bp to feature; MODIFIER silent_mutation Average:15.717; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0825180746 T -> C LOC_Os08g39770.1 upstream_gene_variant ; 3491.0bp to feature; MODIFIER silent_mutation Average:15.717; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0825180746 T -> C LOC_Os08g39760-LOC_Os08g39770 intergenic_region ; MODIFIER silent_mutation Average:15.717; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0825180746 T -> DEL N N silent_mutation Average:15.717; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825180746 NA 9.87E-12 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0825180746 NA 6.98E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746 NA 2.45E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746 NA 5.17E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746 4.12E-09 3.48E-24 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746 7.82E-08 1.76E-09 mr1874 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746 NA 1.57E-17 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746 NA 6.08E-07 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746 4.01E-12 7.38E-39 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746 4.02E-10 1.51E-14 mr1874_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251