\
| Variant ID: vg0825180746 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25180746 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GATATTTCCAAAATTTTCGGATATATCTGAAAATTTTCGAAGTCAGCACAAATAGCAAAGTAAATCCTAGATCTAGTTGCCTACAACAAGAATATGCTAG[T/C]
ACAAATAGCAACTAGACCTATAGCGGCTCGAACAAGCAAAGCTAGTGGAGAGGGAGGAAGTAAAGTCACCAAAGATGAAGCTCACGAGGTTGTTCCCGAA
TTCGGGAACAACCTCGTGAGCTTCATCTTTGGTGACTTTACTTCCTCCCTCTCCACTAGCTTTGCTTGTTCGAGCCGCTATAGGTCTAGTTGCTATTTGT[A/G]
CTAGCATATTCTTGTTGTAGGCAACTAGATCTAGGATTTACTTTGCTATTTGTGCTGACTTCGAAAATTTTCAGATATATCCGAAAATTTTGGAAATATC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 21.80% | 3.43% | 0.30% | NA |
| All Indica | 2759 | 66.10% | 27.70% | 5.65% | 0.51% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.13% | 0.00% | NA |
| Aus | 269 | 8.60% | 91.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 82.50% | 2.50% | 13.61% | 1.34% | NA |
| Indica II | 465 | 78.10% | 19.80% | 2.15% | 0.00% | NA |
| Indica III | 913 | 49.60% | 46.20% | 3.61% | 0.55% | NA |
| Indica Intermediate | 786 | 65.90% | 29.90% | 4.07% | 0.13% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 12.20% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825180746 | T -> C | LOC_Os08g39760.1 | upstream_gene_variant ; 235.0bp to feature; MODIFIER | silent_mutation | Average:15.717; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0825180746 | T -> C | LOC_Os08g39770.1 | upstream_gene_variant ; 3491.0bp to feature; MODIFIER | silent_mutation | Average:15.717; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0825180746 | T -> C | LOC_Os08g39760-LOC_Os08g39770 | intergenic_region ; MODIFIER | silent_mutation | Average:15.717; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0825180746 | T -> DEL | N | N | silent_mutation | Average:15.717; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825180746 | NA | 9.87E-12 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0825180746 | NA | 6.98E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825180746 | NA | 2.45E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825180746 | NA | 5.17E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825180746 | 4.12E-09 | 3.48E-24 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825180746 | 7.82E-08 | 1.76E-09 | mr1874 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825180746 | NA | 1.57E-17 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825180746 | NA | 6.08E-07 | mr1699_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825180746 | 4.01E-12 | 7.38E-39 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825180746 | 4.02E-10 | 1.51E-14 | mr1874_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |