Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0825180746:

Variant ID: vg0825180746 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25180746
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATATTTCCAAAATTTTCGGATATATCTGAAAATTTTCGAAGTCAGCACAAATAGCAAAGTAAATCCTAGATCTAGTTGCCTACAACAAGAATATGCTAG[T/C]
ACAAATAGCAACTAGACCTATAGCGGCTCGAACAAGCAAAGCTAGTGGAGAGGGAGGAAGTAAAGTCACCAAAGATGAAGCTCACGAGGTTGTTCCCGAA

Reverse complement sequence

TTCGGGAACAACCTCGTGAGCTTCATCTTTGGTGACTTTACTTCCTCCCTCTCCACTAGCTTTGCTTGTTCGAGCCGCTATAGGTCTAGTTGCTATTTGT[A/G]
CTAGCATATTCTTGTTGTAGGCAACTAGATCTAGGATTTACTTTGCTATTTGTGCTGACTTCGAAAATTTTCAGATATATCCGAAAATTTTGGAAATATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	21.80%	3.43%	0.30%	NA
All Indica	2759	66.10%	27.70%	5.65%	0.51%	NA
All Japonica	1512	99.70%	0.20%	0.13%	0.00%	NA
Aus	269	8.60%	91.40%	0.00%	0.00%	NA
Indica I	595	82.50%	2.50%	13.61%	1.34%	NA
Indica II	465	78.10%	19.80%	2.15%	0.00%	NA
Indica III	913	49.60%	46.20%	3.61%	0.55%	NA
Indica Intermediate	786	65.90%	29.90%	4.07%	0.13%	NA
Temperate Japonica	767	99.60%	0.10%	0.26%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	12.20%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825180746	T -> C	LOC_Os08g39760.1	upstream_gene_variant ; 235.0bp to feature; MODIFIER	silent_mutation	Average:15.717; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0825180746	T -> C	LOC_Os08g39770.1	upstream_gene_variant ; 3491.0bp to feature; MODIFIER	silent_mutation	Average:15.717; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0825180746	T -> C	LOC_Os08g39760-LOC_Os08g39770	intergenic_region ; MODIFIER	silent_mutation	Average:15.717; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0825180746	T -> DEL	N	N	silent_mutation	Average:15.717; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825180746	NA	9.87E-12	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0825180746	NA	6.98E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746	NA	2.45E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746	NA	5.17E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746	4.12E-09	3.48E-24	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746	7.82E-08	1.76E-09	mr1874	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746	NA	1.57E-17	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746	NA	6.08E-07	mr1699_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746	4.01E-12	7.38E-39	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825180746	4.02E-10	1.51E-14	mr1874_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251