Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0825151824:

Variant ID: vg0825151824 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 25151824
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.35, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GACCTTATAGTTTTTAGAGTTTATCGTCTCGTTGGGTTTCATTTTCTTTATAATTTAGAAATCCCGTCAAACGCTGCTACTATACTCCTCTATAACCTGT[T/C]
CGCCGCATACACTTTATTGTCATTGGGATTGTAAAAGTCGAACATAACTATCATTAGAATTTATTATTTTTACTTTCTAGAAGACATATCAACCATCGGC

Reverse complement sequence

GCCGATGGTTGATATGTCTTCTAGAAAGTAAAAATAATAAATTCTAATGATAGTTATGTTCGACTTTTACAATCCCAATGACAATAAAGTGTATGCGGCG[A/G]
ACAGGTTATAGAGGAGTATAGTAGCAGCGTTTGACGGGATTTCTAAATTATAAAGAAAATGAAACCCAACGAGACGATAAACTCTAAAAACTATAAGGTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.00%	30.80%	0.15%	0.00%	NA
All Indica	2759	57.10%	42.70%	0.22%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	6.30%	93.70%	0.00%	0.00%	NA
Indica I	595	66.40%	33.30%	0.34%	0.00%	NA
Indica II	465	75.90%	24.10%	0.00%	0.00%	NA
Indica III	913	39.60%	60.40%	0.00%	0.00%	NA
Indica Intermediate	786	59.30%	40.20%	0.51%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	80.00%	18.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0825151824	T -> C	LOC_Os08g39720.1	upstream_gene_variant ; 4850.0bp to feature; MODIFIER	silent_mutation	Average:21.825; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0825151824	T -> C	LOC_Os08g39730.1	upstream_gene_variant ; 3334.0bp to feature; MODIFIER	silent_mutation	Average:21.825; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0825151824	T -> C	LOC_Os08g39720-LOC_Os08g39730	intergenic_region ; MODIFIER	silent_mutation	Average:21.825; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0825151824	NA	3.03E-07	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151824	NA	2.31E-07	mr1699	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151824	2.61E-20	9.30E-45	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151824	3.81E-19	5.19E-26	mr1874	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151824	NA	7.82E-06	mr1887	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151824	NA	9.44E-08	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151824	NA	1.26E-17	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151824	1.62E-08	NA	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151824	2.01E-08	3.67E-11	mr1699_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151824	2.73E-24	1.83E-66	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825151824	2.12E-22	6.21E-35	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251