\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825106864:

Variant ID: vg0825106864 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25106864
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTTGGTGAGGAGAGAACATCCTATAAATACTCAAAACAACAGCTGTAATAACTTGGCTTAGAACTCGGCGGCGGCGGTGGCTTGGTCCGGTTGGACGC[A/G]
AGAGAGAAATCTATTAATCGAGTTCCTCGTATCATCTTGTTCTTGTGTGCTTGTGTGAATCGTGAGCTAGGGTTCTAACAAAATCTGGTATCAGAGCTTC

Reverse complement sequence

GAAGCTCTGATACCAGATTTTGTTAGAACCCTAGCTCACGATTCACACAAGCACACAAGAACAAGATGATACGAGGAACTCGATTAATAGATTTCTCTCT[T/C]
GCGTCCAACCGGACCAAGCCACCGCCGCCGCCGAGTTCTAAGCCAAGTTATTACAGCTGTTGTTTTGAGTATTTATAGGATGTTCTCTCCTCACCAACTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 23.90% 0.23% 0.02% NA
All Indica  2759 68.90% 30.70% 0.40% 0.04% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 5.90% 94.10% 0.00% 0.00% NA
Indica I  595 65.70% 33.40% 0.84% 0.00% NA
Indica II  465 89.00% 10.80% 0.00% 0.22% NA
Indica III  913 63.90% 36.00% 0.11% 0.00% NA
Indica Intermediate  786 65.10% 34.20% 0.64% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825106864 A -> G LOC_Os08g39650.1 upstream_gene_variant ; 263.0bp to feature; MODIFIER silent_mutation Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N
vg0825106864 A -> G LOC_Os08g39640.1 downstream_gene_variant ; 1248.0bp to feature; MODIFIER silent_mutation Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N
vg0825106864 A -> G LOC_Os08g39660.1 downstream_gene_variant ; 2791.0bp to feature; MODIFIER silent_mutation Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N
vg0825106864 A -> G LOC_Os08g39640-LOC_Os08g39650 intergenic_region ; MODIFIER silent_mutation Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N
vg0825106864 A -> DEL N N silent_mutation Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0825106864 NA 5.18E-09 mr1545 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864 8.20E-26 7.75E-50 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864 1.45E-27 4.08E-34 mr1874 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864 NA 7.77E-08 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864 NA 2.14E-10 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864 2.39E-06 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864 2.65E-06 7.03E-08 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864 6.36E-33 1.29E-77 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0825106864 2.06E-34 6.69E-48 mr1874_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251