\
| Variant ID: vg0825106864 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25106864 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 182. )
GAGTTGGTGAGGAGAGAACATCCTATAAATACTCAAAACAACAGCTGTAATAACTTGGCTTAGAACTCGGCGGCGGCGGTGGCTTGGTCCGGTTGGACGC[A/G]
AGAGAGAAATCTATTAATCGAGTTCCTCGTATCATCTTGTTCTTGTGTGCTTGTGTGAATCGTGAGCTAGGGTTCTAACAAAATCTGGTATCAGAGCTTC
GAAGCTCTGATACCAGATTTTGTTAGAACCCTAGCTCACGATTCACACAAGCACACAAGAACAAGATGATACGAGGAACTCGATTAATAGATTTCTCTCT[T/C]
GCGTCCAACCGGACCAAGCCACCGCCGCCGCCGAGTTCTAAGCCAAGTTATTACAGCTGTTGTTTTGAGTATTTATAGGATGTTCTCTCCTCACCAACTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.90% | 23.90% | 0.23% | 0.02% | NA |
| All Indica | 2759 | 68.90% | 30.70% | 0.40% | 0.04% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 5.90% | 94.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.70% | 33.40% | 0.84% | 0.00% | NA |
| Indica II | 465 | 89.00% | 10.80% | 0.00% | 0.22% | NA |
| Indica III | 913 | 63.90% | 36.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 65.10% | 34.20% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825106864 | A -> G | LOC_Os08g39650.1 | upstream_gene_variant ; 263.0bp to feature; MODIFIER | silent_mutation | Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813 | N | N | N | N |
| vg0825106864 | A -> G | LOC_Os08g39640.1 | downstream_gene_variant ; 1248.0bp to feature; MODIFIER | silent_mutation | Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813 | N | N | N | N |
| vg0825106864 | A -> G | LOC_Os08g39660.1 | downstream_gene_variant ; 2791.0bp to feature; MODIFIER | silent_mutation | Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813 | N | N | N | N |
| vg0825106864 | A -> G | LOC_Os08g39640-LOC_Os08g39650 | intergenic_region ; MODIFIER | silent_mutation | Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813 | N | N | N | N |
| vg0825106864 | A -> DEL | N | N | silent_mutation | Average:48.293; most accessible tissue: Zhenshan97 flower, score: 63.813 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825106864 | NA | 5.18E-09 | mr1545 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825106864 | 8.20E-26 | 7.75E-50 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825106864 | 1.45E-27 | 4.08E-34 | mr1874 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825106864 | NA | 7.77E-08 | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825106864 | NA | 2.14E-10 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825106864 | 2.39E-06 | NA | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825106864 | 2.65E-06 | 7.03E-08 | mr1699_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825106864 | 6.36E-33 | 1.29E-77 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825106864 | 2.06E-34 | 6.69E-48 | mr1874_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |