\
| Variant ID: vg0825050663 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25050663 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 232. )
TTGCTGTGTCCTATTTAACTGAACTACGCTCTTTTCTGGATTGCTACAATATAATAATTGACTGTAGCTCTTTTTGAGTAAAGGCTGGGATGTTAAATTC[C/T]
ATTATCTAAAAAAAATGCTCGAGCTCGAGGAAGGAATCGATCGAGTGGATGGACAAAGCTGAAGAGACAGGTGACTGGATTGAGTAAGAAAGGGGCAATT
AATTGCCCCTTTCTTACTCAATCCAGTCACCTGTCTCTTCAGCTTTGTCCATCCACTCGATCGATTCCTTCCTCGAGCTCGAGCATTTTTTTTAGATAAT[G/A]
GAATTTAACATCCCAGCCTTTACTCAAAAAGAGCTACAGTCAATTATTATATTGTAGCAATCCAGAAAAGAGCGTAGTTCAGTTAAATAGGACACAGCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.10% | 12.90% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 87.60% | 12.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 7.80% | 91.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.70% | 19.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825050663 | C -> T | LOC_Os08g39580.1 | upstream_gene_variant ; 3286.0bp to feature; MODIFIER | silent_mutation | Average:45.987; most accessible tissue: Zhenshan97 root, score: 65.566 | N | N | N | N |
| vg0825050663 | C -> T | LOC_Os08g39580-LOC_Os08g39590 | intergenic_region ; MODIFIER | silent_mutation | Average:45.987; most accessible tissue: Zhenshan97 root, score: 65.566 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825050663 | NA | 5.21E-10 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0825050663 | NA | 1.39E-06 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | 3.55E-11 | 2.64E-21 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | 4.30E-08 | 1.43E-06 | mr1874 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | NA | 1.21E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | NA | 7.93E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | NA | 9.99E-07 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | NA | 8.94E-07 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | NA | 6.09E-08 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | NA | 8.60E-10 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | NA | 2.39E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | NA | 2.66E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | 8.68E-13 | 1.17E-36 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | 2.88E-11 | 1.69E-12 | mr1874_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | NA | 5.80E-08 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825050663 | NA | 3.31E-06 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |