\
| Variant ID: vg0825021665 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 25021665 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, A: 0.23, others allele: 0.00, population size: 88. )
TTTTAAACTACTAAACGGCGTGTTTTTATGCAACTATATATATATACCCACACACACGACAGTTGTTTTGAAAAAATTATATTAATCCATTTTGCAAAAA[T/A]
AATAATACTTAATTATTTATGTAAGAATATGTGCTTCGTTTTACGTGCCAGGAACCCCTTCCGAACGCAGCCTAAAAGTTTTACTCGTAATTTATCTTTG
CAAAGATAAATTACGAGTAAAACTTTTAGGCTGCGTTCGGAAGGGGTTCCTGGCACGTAAAACGAAGCACATATTCTTACATAAATAATTAAGTATTATT[A/T]
TTTTTGCAAAATGGATTAATATAATTTTTTCAAAACAACTGTCGTGTGTGTGGGTATATATATATAGTTGCATAAAAACACGCCGTTTAGTAGTTTAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.50% | 31.30% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 56.30% | 43.50% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 6.30% | 93.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.70% | 33.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 69.70% | 29.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 39.80% | 60.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 60.60% | 39.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 18.90% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0825021665 | T -> A | LOC_Os08g39550.1 | upstream_gene_variant ; 4302.0bp to feature; MODIFIER | silent_mutation | Average:47.639; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0825021665 | T -> A | LOC_Os08g39560.1 | upstream_gene_variant ; 1650.0bp to feature; MODIFIER | silent_mutation | Average:47.639; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0825021665 | T -> A | LOC_Os08g39550-LOC_Os08g39560 | intergenic_region ; MODIFIER | silent_mutation | Average:47.639; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0825021665 | NA | 5.99E-06 | mr1699 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825021665 | 9.55E-18 | 1.08E-40 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825021665 | 1.66E-16 | 1.85E-22 | mr1874 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825021665 | NA | 2.76E-08 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825021665 | NA | 2.28E-10 | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825021665 | 3.26E-09 | NA | mr1699_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825021665 | 1.43E-08 | 1.39E-12 | mr1699_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825021665 | 2.82E-20 | 9.07E-57 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0825021665 | 6.45E-19 | 1.09E-27 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |