Variant ID: vg0824847711 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 24847711 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 30. )
ATTTCGAAATGCCTGAAACTTCTGTAGAAGTTTATTGGAATTTGATGTGCTCTTCAGCTTCTCGGGATGACTATTGCCTCGTTTTTTCATGAGCACACTT[C/T]
CTAAACTATTAAACTATATTAAGCTGTATATGTATTTTTTTATTGAATAGTTTCTTGAAAAATCAAATAAACTATGTTTATTGAATAGCCACTAAAAAGC
GCTTTTTAGTGGCTATTCAATAAACATAGTTTATTTGATTTTTCAAGAAACTATTCAATAAAAAAATACATATACAGCTTAATATAGTTTAATAGTTTAG[G/A]
AAGTGTGCTCATGAAAAAACGAGGCAATAGTCATCCCGAGAAGCTGAAGAGCACATCAAATTCCAATAAACTTCTACAGAAGTTTCAGGCATTTCGAAAT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 69.10% | 13.50% | 12.42% | 4.99% | NA |
All Indica | 2759 | 56.00% | 22.30% | 14.17% | 7.50% | NA |
All Japonica | 1512 | 99.40% | 0.40% | 0.13% | 0.07% | NA |
Aus | 269 | 23.40% | 0.00% | 66.91% | 9.67% | NA |
Indica I | 595 | 60.80% | 29.90% | 9.24% | 0.00% | NA |
Indica II | 465 | 35.90% | 52.70% | 6.88% | 4.52% | NA |
Indica III | 913 | 62.00% | 0.10% | 22.45% | 15.44% | NA |
Indica Intermediate | 786 | 57.40% | 24.30% | 12.60% | 5.73% | NA |
Temperate Japonica | 767 | 99.20% | 0.40% | 0.26% | 0.13% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 93.80% | 0.00% | 6.25% | 0.00% | NA |
Intermediate | 90 | 72.20% | 16.70% | 8.89% | 2.22% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0824847711 | C -> T | LOC_Os08g39320.1 | upstream_gene_variant ; 3527.0bp to feature; MODIFIER | silent_mutation | Average:66.572; most accessible tissue: Callus, score: 84.714 | N | N | N | N |
vg0824847711 | C -> T | LOC_Os08g39320-LOC_Os08g39330 | intergenic_region ; MODIFIER | silent_mutation | Average:66.572; most accessible tissue: Callus, score: 84.714 | N | N | N | N |
vg0824847711 | C -> DEL | N | N | silent_mutation | Average:66.572; most accessible tissue: Callus, score: 84.714 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0824847711 | NA | 7.21E-06 | mr1212 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824847711 | NA | 9.14E-09 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824847711 | 5.50E-06 | NA | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824847711 | 3.76E-07 | 7.13E-10 | mr1699 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824847711 | NA | 3.81E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824847711 | 4.94E-06 | NA | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824847711 | NA | 7.23E-09 | mr1874 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824847711 | 3.24E-07 | NA | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824847711 | 7.27E-07 | 3.84E-12 | mr1699_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824847711 | 5.66E-06 | NA | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0824847711 | 5.27E-06 | 1.26E-12 | mr1874_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |