Variant ID: vg0823689104 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 23689104 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 232. )
TTTTATTTGAGAAACTTAGTACAAGCGTGGCCATGAACATACACACCCACAATCTAAACCGACCTATAAGCACATATTTAATTAAAAACTAGTTGGATGG[C/T]
CCGCGCAATTACTCGGCTAACACCCAAACAAAATCATATAATTTTTAAGTATGATTTTACTTAAAATTTATTAAATAGCTATCTTCTTCTCTTAGGACTT
AAGTCCTAAGAGAAGAAGATAGCTATTTAATAAATTTTAAGTAAAATCATACTTAAAAATTATATGATTTTGTTTGGGTGTTAGCCGAGTAATTGCGCGG[G/A]
CCATCCAACTAGTTTTTAATTAAATATGTGCTTATAGGTCGGTTTAGATTGTGGGTGTGTATGTTCATGGCCACGCTTGTACTAAGTTTCTCAAATAAAA
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 69.80% | 26.80% | 3.36% | 0.00% | NA |
All Indica | 2759 | 90.50% | 6.80% | 2.68% | 0.00% | NA |
All Japonica | 1512 | 47.70% | 47.20% | 5.16% | 0.00% | NA |
Aus | 269 | 4.80% | 94.80% | 0.37% | 0.00% | NA |
Indica I | 595 | 86.90% | 7.20% | 5.88% | 0.00% | NA |
Indica II | 465 | 89.70% | 8.40% | 1.94% | 0.00% | NA |
Indica III | 913 | 95.20% | 4.60% | 0.22% | 0.00% | NA |
Indica Intermediate | 786 | 88.30% | 8.10% | 3.56% | 0.00% | NA |
Temperate Japonica | 767 | 38.30% | 53.80% | 7.82% | 0.00% | NA |
Tropical Japonica | 504 | 62.30% | 35.50% | 2.18% | 0.00% | NA |
Japonica Intermediate | 241 | 46.90% | 50.20% | 2.90% | 0.00% | NA |
VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
Intermediate | 90 | 66.70% | 26.70% | 6.67% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0823689104 | C -> T | LOC_Os08g37410-LOC_Os08g37420 | intergenic_region ; MODIFIER | silent_mutation | Average:54.817; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0823689104 | NA | 8.50E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823689104 | NA | 1.95E-09 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823689104 | NA | 1.46E-06 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823689104 | NA | 2.54E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823689104 | NA | 4.39E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823689104 | 1.53E-06 | 1.53E-06 | mr1728 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0823689104 | NA | 1.23E-07 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |