Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0822237686:

Variant ID: vg0822237686 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 22237686
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TGATATTACAACTACTAATAGAAAAACAATTTACTACTACGAGGCTGATTAACTACAGGCTGACTGTATTTTCAGTTGGGGCGGCCTGGTTGCAAAACAA[T/C]
ATGATTTTCGTAAACACATGCTAAGTGGCGGGCTGTCTGCGTAAAGCGATTTGATCGCCTGAAAAAATGGTTTTCATAGTATCGAACACCAAAAGAAAAT

Reverse complement sequence

ATTTTCTTTTGGTGTTCGATACTATGAAAACCATTTTTTCAGGCGATCAAATCGCTTTACGCAGACAGCCCGCCACTTAGCATGTGTTTACGAAAATCAT[A/G]
TTGTTTTGCAACCAGGCCGCCCCAACTGAAAATACAGTCAGCCTGTAGTTAATCAGCCTCGTAGTAGTAAATTGTTTTTCTATTAGTAGTTGTAATATCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	26.50%	0.13%	0.00%	NA
All Indica	2759	98.70%	1.30%	0.00%	0.00%	NA
All Japonica	1512	29.80%	69.80%	0.40%	0.00%	NA
Aus	269	49.40%	50.60%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	96.70%	3.30%	0.00%	0.00%	NA
Temperate Japonica	767	10.20%	89.70%	0.13%	0.00%	NA
Tropical Japonica	504	62.30%	37.30%	0.40%	0.00%	NA
Japonica Intermediate	241	24.10%	74.70%	1.24%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0822237686	T -> C	LOC_Os08g35250.1	upstream_gene_variant ; 4244.0bp to feature; MODIFIER	silent_mutation	Average:51.87; most accessible tissue: Callus, score: 80.154	N	N	N	N
vg0822237686	T -> C	LOC_Os08g35230.1	downstream_gene_variant ; 2236.0bp to feature; MODIFIER	silent_mutation	Average:51.87; most accessible tissue: Callus, score: 80.154	N	N	N	N
vg0822237686	T -> C	LOC_Os08g35240.1	downstream_gene_variant ; 436.0bp to feature; MODIFIER	silent_mutation	Average:51.87; most accessible tissue: Callus, score: 80.154	N	N	N	N
vg0822237686	T -> C	LOC_Os08g35240-LOC_Os08g35250	intergenic_region ; MODIFIER	silent_mutation	Average:51.87; most accessible tissue: Callus, score: 80.154	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0822237686	NA	6.34E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822237686	NA	9.91E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822237686	NA	9.28E-06	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822237686	NA	5.01E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822237686	NA	3.88E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822237686	NA	8.58E-09	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822237686	NA	2.85E-08	mr1844	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822237686	NA	5.43E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822237686	NA	7.27E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0822237686	NA	2.64E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251