| Variant ID: vg0822237686 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 22237686 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 245. )
TGATATTACAACTACTAATAGAAAAACAATTTACTACTACGAGGCTGATTAACTACAGGCTGACTGTATTTTCAGTTGGGGCGGCCTGGTTGCAAAACAA[T/C]
ATGATTTTCGTAAACACATGCTAAGTGGCGGGCTGTCTGCGTAAAGCGATTTGATCGCCTGAAAAAATGGTTTTCATAGTATCGAACACCAAAAGAAAAT
ATTTTCTTTTGGTGTTCGATACTATGAAAACCATTTTTTCAGGCGATCAAATCGCTTTACGCAGACAGCCCGCCACTTAGCATGTGTTTACGAAAATCAT[A/G]
TTGTTTTGCAACCAGGCCGCCCCAACTGAAAATACAGTCAGCCTGTAGTTAATCAGCCTCGTAGTAGTAAATTGTTTTTCTATTAGTAGTTGTAATATCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.40% | 26.50% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 29.80% | 69.80% | 0.40% | 0.00% | NA |
| Aus | 269 | 49.40% | 50.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 10.20% | 89.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 62.30% | 37.30% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 24.10% | 74.70% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0822237686 | T -> C | LOC_Os08g35250.1 | upstream_gene_variant ; 4244.0bp to feature; MODIFIER | silent_mutation | Average:51.87; most accessible tissue: Callus, score: 80.154 | N | N | N | N |
| vg0822237686 | T -> C | LOC_Os08g35230.1 | downstream_gene_variant ; 2236.0bp to feature; MODIFIER | silent_mutation | Average:51.87; most accessible tissue: Callus, score: 80.154 | N | N | N | N |
| vg0822237686 | T -> C | LOC_Os08g35240.1 | downstream_gene_variant ; 436.0bp to feature; MODIFIER | silent_mutation | Average:51.87; most accessible tissue: Callus, score: 80.154 | N | N | N | N |
| vg0822237686 | T -> C | LOC_Os08g35240-LOC_Os08g35250 | intergenic_region ; MODIFIER | silent_mutation | Average:51.87; most accessible tissue: Callus, score: 80.154 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0822237686 | NA | 6.34E-06 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822237686 | NA | 9.91E-06 | mr1096 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822237686 | NA | 9.28E-06 | mr1211 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822237686 | NA | 5.01E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822237686 | NA | 3.88E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822237686 | NA | 8.58E-09 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822237686 | NA | 2.85E-08 | mr1844 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822237686 | NA | 5.43E-12 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822237686 | NA | 7.27E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0822237686 | NA | 2.64E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |