\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0821271128:

Variant ID: vg0821271128 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 21271128
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATACTTTATTAGCAAATGATTACTTTGTCAAATAAATCATGGCGTAATTAGGTTTAGAGATTTATCTCATAATTTACATGTAATATGTATAAATAGTT[C/T]
TTTCTATGTCTATATTTAATACTCTATGATGCATGTGTCCAAATATTTGATATGATAAGGTAAAAAGTTGTTGTTTGGAAACTATACAGGGCATAAGTGT

Reverse complement sequence

ACACTTATGCCCTGTATAGTTTCCAAACAACAACTTTTTACCTTATCATATCAAATATTTGGACACATGCATCATAGAGTATTAAATATAGACATAGAAA[G/A]
AACTATTTATACATATTACATGTAAATTATGAGATAAATCTCTAAACCTAATTACGCCATGATTTATTTGACAAAGTAATCATTTGCTAATAAAGTATTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 9.00% 3.26% 0.00% NA
All Indica  2759 99.70% 0.30% 0.04% 0.00% NA
All Japonica  1512 63.40% 26.70% 9.92% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 34.80% 48.80% 16.43% 0.00% NA
Tropical Japonica  504 97.20% 1.60% 1.19% 0.00% NA
Japonica Intermediate  241 83.40% 9.10% 7.47% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 14.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0821271128 C -> T LOC_Os08g33970.1 upstream_gene_variant ; 1512.0bp to feature; MODIFIER silent_mutation Average:58.899; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0821271128 C -> T LOC_Os08g33980.1 upstream_gene_variant ; 2080.0bp to feature; MODIFIER silent_mutation Average:58.899; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg0821271128 C -> T LOC_Os08g33960-LOC_Os08g33970 intergenic_region ; MODIFIER silent_mutation Average:58.899; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0821271128 NA 3.60E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821271128 NA 6.09E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821271128 NA 1.54E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821271128 NA 6.05E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821271128 NA 7.39E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821271128 NA 2.96E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821271128 NA 4.33E-08 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821271128 NA 3.78E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821271128 3.58E-06 NA mr1530_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821271128 NA 5.52E-12 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821271128 NA 1.07E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0821271128 NA 5.89E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251