Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820982018:

Variant ID: vg0820982018 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20982018
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

CGCATGCATGCGTGCGTTCGTGCCTCCACGCGGTAGCTATAGGAGGTGGAGTAGGCCGGTTTGATGCGGTAGAGCGCTGGAGAAAGATAAAAAGGATTTT[C/T]
GCAGATGGCCAAAATTGCTCTGTGCAGGTGGACACAAGCGTCGTCTACAAGTAGAGATTTACGAAAATCATCGATTTTCACACGAGGTTTTCGCAGGTAG

Reverse complement sequence

CTACCTGCGAAAACCTCGTGTGAAAATCGATGATTTTCGTAAATCTCTACTTGTAGACGACGCTTGTGTCCACCTGCACAGAGCAATTTTGGCCATCTGC[G/A]
AAAATCCTTTTTATCTTTCTCCAGCGCTCTACCGCATCAAACCGGCCTACTCCACCTCCTATAGCTACCGCGTGGAGGCACGAACGCACGCATGCATGCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.90%	46.00%	0.15%	0.00%	NA
All Indica	2759	87.70%	12.10%	0.14%	0.00%	NA
All Japonica	1512	3.00%	97.00%	0.07%	0.00%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	84.90%	15.10%	0.00%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	86.40%	13.50%	0.11%	0.00%	NA
Indica Intermediate	786	86.30%	13.40%	0.38%	0.00%	NA
Temperate Japonica	767	2.00%	98.00%	0.00%	0.00%	NA
Tropical Japonica	504	3.80%	96.00%	0.20%	0.00%	NA
Japonica Intermediate	241	4.60%	95.40%	0.00%	0.00%	NA
VI/Aromatic	96	37.50%	62.50%	0.00%	0.00%	NA
Intermediate	90	42.20%	55.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820982018	C -> T	LOC_Os08g33590.1	upstream_gene_variant ; 4764.0bp to feature; MODIFIER	silent_mutation	Average:52.534; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0820982018	C -> T	LOC_Os08g33600.1	upstream_gene_variant ; 678.0bp to feature; MODIFIER	silent_mutation	Average:52.534; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0820982018	C -> T	LOC_Os08g33610.1	downstream_gene_variant ; 2557.0bp to feature; MODIFIER	silent_mutation	Average:52.534; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0820982018	C -> T	LOC_Os08g33590-LOC_Os08g33600	intergenic_region ; MODIFIER	silent_mutation	Average:52.534; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820982018	NA	1.23E-17	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	5.45E-18	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	8.25E-43	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	1.99E-26	mr1551	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	3.59E-19	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	1.13E-30	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	2.59E-28	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	1.41E-17	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	4.37E-15	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	5.92E-62	mr1970	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	7.05E-51	mr1063_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	3.80E-13	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	4.53E-21	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	2.01E-15	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	4.81E-20	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	5.42E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	3.13E-06	5.20E-27	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	9.26E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	7.47E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	1.14E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	1.18E-45	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	2.40E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	6.83E-59	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	3.55E-06	3.92E-14	mr1781_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	6.03E-51	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	2.83E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	2.11E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	6.91E-25	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	1.33E-62	mr1970_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018	NA	4.63E-98	mr1973_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251