\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820982018:

Variant ID: vg0820982018 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20982018
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CGCATGCATGCGTGCGTTCGTGCCTCCACGCGGTAGCTATAGGAGGTGGAGTAGGCCGGTTTGATGCGGTAGAGCGCTGGAGAAAGATAAAAAGGATTTT[C/T]
GCAGATGGCCAAAATTGCTCTGTGCAGGTGGACACAAGCGTCGTCTACAAGTAGAGATTTACGAAAATCATCGATTTTCACACGAGGTTTTCGCAGGTAG

Reverse complement sequence

CTACCTGCGAAAACCTCGTGTGAAAATCGATGATTTTCGTAAATCTCTACTTGTAGACGACGCTTGTGTCCACCTGCACAGAGCAATTTTGGCCATCTGC[G/A]
AAAATCCTTTTTATCTTTCTCCAGCGCTCTACCGCATCAAACCGGCCTACTCCACCTCCTATAGCTACCGCGTGGAGGCACGAACGCACGCATGCATGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 46.00% 0.15% 0.00% NA
All Indica  2759 87.70% 12.10% 0.14% 0.00% NA
All Japonica  1512 3.00% 97.00% 0.07% 0.00% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 84.90% 15.10% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 86.40% 13.50% 0.11% 0.00% NA
Indica Intermediate  786 86.30% 13.40% 0.38% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 3.80% 96.00% 0.20% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 37.50% 62.50% 0.00% 0.00% NA
Intermediate  90 42.20% 55.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820982018 C -> T LOC_Os08g33590.1 upstream_gene_variant ; 4764.0bp to feature; MODIFIER silent_mutation Average:52.534; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0820982018 C -> T LOC_Os08g33600.1 upstream_gene_variant ; 678.0bp to feature; MODIFIER silent_mutation Average:52.534; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0820982018 C -> T LOC_Os08g33610.1 downstream_gene_variant ; 2557.0bp to feature; MODIFIER silent_mutation Average:52.534; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0820982018 C -> T LOC_Os08g33590-LOC_Os08g33600 intergenic_region ; MODIFIER silent_mutation Average:52.534; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820982018 NA 1.23E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 5.45E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 8.25E-43 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 1.99E-26 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 3.59E-19 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 1.13E-30 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 2.59E-28 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 1.41E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 4.37E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 5.92E-62 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 7.05E-51 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 3.80E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 4.53E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 2.01E-15 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 4.81E-20 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 5.42E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 3.13E-06 5.20E-27 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 9.26E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 7.47E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 1.14E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 1.18E-45 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 2.40E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 6.83E-59 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 3.55E-06 3.92E-14 mr1781_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 6.03E-51 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 2.83E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 2.11E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 6.91E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 1.33E-62 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820982018 NA 4.63E-98 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251