\
| Variant ID: vg0820747994 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20747994 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 96. )
CTTCTAAGCAGACTCAACCATTCACCATTTATGAAGGGACGCTAAAAATTTTCTTTCTCAACCTTAGTTAAGCAACCTATAGTTCTTACATATTGACGTG[C/T]
AATTCTTTTACGCATTCGGAAATAAAAAAGTTAAGCAACCTATAGCTAGCTATACTTACGTTTTAAAATGGACTGTGGTATACGTCCATATGCATGCATT
AATGCATGCATATGGACGTATACCACAGTCCATTTTAAAACGTAAGTATAGCTAGCTATAGGTTGCTTAACTTTTTTATTTCCGAATGCGTAAAAGAATT[G/A]
CACGTCAATATGTAAGAACTATAGGTTGCTTAACTAAGGTTGAGAAAGAAAATTTTTAGCGTCCCTTCATAAATGGTGAATGGTTGAGTCTGCTTAGAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 44.40% | 0.25% | 0.19% | NA |
| All Indica | 2759 | 91.90% | 7.40% | 0.33% | 0.33% | NA |
| All Japonica | 1512 | 1.30% | 98.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 9.30% | 90.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.80% | 2.00% | 0.50% | 0.67% | NA |
| Indica II | 465 | 93.30% | 6.00% | 0.43% | 0.22% | NA |
| Indica III | 913 | 92.30% | 7.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.90% | 12.20% | 0.38% | 0.51% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 97.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 97.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 31.10% | 67.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820747994 | C -> T | LOC_Os08g33290.1 | downstream_gene_variant ; 2490.0bp to feature; MODIFIER | silent_mutation | Average:61.559; most accessible tissue: Callus, score: 85.17 | N | N | N | N |
| vg0820747994 | C -> T | LOC_Os08g33290-LOC_Os08g33300 | intergenic_region ; MODIFIER | silent_mutation | Average:61.559; most accessible tissue: Callus, score: 85.17 | N | N | N | N |
| vg0820747994 | C -> DEL | N | N | silent_mutation | Average:61.559; most accessible tissue: Callus, score: 85.17 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820747994 | NA | 3.91E-26 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820747994 | NA | 1.68E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820747994 | NA | 8.24E-06 | mr1157 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820747994 | 5.92E-06 | 3.03E-06 | mr1328 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820747994 | NA | 6.11E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820747994 | 5.30E-07 | 8.84E-08 | mr1446 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820747994 | NA | 4.37E-25 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820747994 | NA | 5.08E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820747994 | NA | 1.28E-25 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820747994 | 2.48E-07 | 2.25E-07 | mr1712 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820747994 | NA | 3.75E-30 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820747994 | NA | 2.53E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820747994 | NA | 2.18E-27 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820747994 | NA | 5.12E-14 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |