\
| Variant ID: vg0820664167 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20664167 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 336. )
AAGGAGAATGAAACAGAAGCTTTTCAAGCACTGTTACCAAGCTTTTGGCAGGTAAAAACATAAGCTTTTATGCTACCAAGCAGGAATATTCGCACAAAAA[G/A]
ATGTCGGGATATCACTCCAACTTCACTTGCAAGTTGGCGCTAGTGGTCCTAGGAATCGTCCGAACGTATGGATACACCCTTAGGGTTCTAAGCTTTTGAA
TTCAAAAGCTTAGAACCCTAAGGGTGTATCCATACGTTCGGACGATTCCTAGGACCACTAGCGCCAACTTGCAAGTGAAGTTGGAGTGATATCCCGACAT[C/T]
TTTTTGTGCGAATATTCCTGCTTGGTAGCATAAAAGCTTATGTTTTTACCTGCCAAAAGCTTGGTAACAGTGCTTGAAAAGCTTCTGTTTCATTCTCCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 3.80% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 94.20% | 5.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.10% | 0.60% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.50% | 6.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 13.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820664167 | G -> A | LOC_Os08g33200.1 | downstream_gene_variant ; 1958.0bp to feature; MODIFIER | silent_mutation | Average:57.703; most accessible tissue: Minghui63 flower, score: 73.71 | N | N | N | N |
| vg0820664167 | G -> A | LOC_Os08g33190-LOC_Os08g33200 | intergenic_region ; MODIFIER | silent_mutation | Average:57.703; most accessible tissue: Minghui63 flower, score: 73.71 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820664167 | NA | 2.13E-11 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820664167 | NA | 2.03E-09 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820664167 | NA | 6.88E-07 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820664167 | NA | 2.04E-07 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820664167 | NA | 5.80E-09 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820664167 | NA | 1.12E-06 | mr1227_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820664167 | NA | 3.68E-09 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820664167 | NA | 2.79E-06 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820664167 | 4.63E-06 | NA | mr1301_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820664167 | NA | 1.81E-06 | mr1403_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820664167 | 7.11E-07 | 1.44E-17 | mr1410_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820664167 | NA | 2.14E-06 | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820664167 | 1.42E-06 | 6.55E-08 | mr1622_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820664167 | NA | 1.65E-08 | mr1993_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |