Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0820586619:

Variant ID: vg0820586619 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20586619
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GACTAAGTGCCTCTTCTGTAAGTATTTTACGCTTTATTTATGTTTGAAACTGTATATTACTTGTCGCTTTATTTACGTTTGGAACTGTATATTACTTGTC[G/A]
TTTTGTGTACCCTGGCTGGTACTGGACAGGGATTTAATACACAAAATAGTCTGGAAATTTGGGTTAAATTTCTGGGCGTGACACTGGTGTTGGCCCATGT

Reverse complement sequence

ACATGGGCCAACACCAGTGTCACGCCCAGAAATTTAACCCAAATTTCCAGACTATTTTGTGTATTAAATCCCTGTCCAGTACCAGCCAGGGTACACAAAA[C/T]
GACAAGTAATATACAGTTCCAAACGTAAATAAAGCGACAAGTAATATACAGTTTCAAACATAAATAAAGCGTAAAATACTTACAGAAGAGGCACTTAGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 2.90% 0.00% 0.00% NA
All Indica  2759 95.00% 5.00% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 85.00% 15.00% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 97.80% 2.20% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820586619 G -> A LOC_Os08g33120.1 upstream_gene_variant ; 3123.0bp to feature; MODIFIER silent_mutation Average:67.066; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg0820586619 G -> A LOC_Os08g33130.1 upstream_gene_variant ; 1047.0bp to feature; MODIFIER silent_mutation Average:67.066; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg0820586619 G -> A LOC_Os08g33140.1 upstream_gene_variant ; 4840.0bp to feature; MODIFIER silent_mutation Average:67.066; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg0820586619 G -> A LOC_Os08g33120.2 upstream_gene_variant ; 4393.0bp to feature; MODIFIER silent_mutation Average:67.066; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg0820586619 G -> A LOC_Os08g33120.3 upstream_gene_variant ; 4393.0bp to feature; MODIFIER silent_mutation Average:67.066; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg0820586619 G -> A LOC_Os08g33120.5 upstream_gene_variant ; 4393.0bp to feature; MODIFIER silent_mutation Average:67.066; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg0820586619 G -> A LOC_Os08g33120-LOC_Os08g33130 intergenic_region ; MODIFIER silent_mutation Average:67.066; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820586619 1.26E-06 1.48E-06 mr1034 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251