Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820513390:

Variant ID: vg0820513390 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 20513390
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

AAGCTTAAGGAAGCTCATGACAACCTCCTTTCCACTACTCAACATGGAGCTCTCATTGATGTTGGCATATCTTGTGATTTGCTTGATGATAGTGCTACTT[G/A]
TCATATTGCTCATGTTGCATCATTTAGCATTTCTACCTCTTGTGATGATCTTGTGGATGTGCCTAGCTCTAGCTCTAGCTCTTGTGTTTCTATTTGTGAT

Reverse complement sequence

ATCACAAATAGAAACACAAGAGCTAGAGCTAGAGCTAGGCACATCCACAAGATCATCACAAGAGGTAGAAATGCTAAATGATGCAACATGAGCAATATGA[C/T]
AAGTAGCACTATCATCAAGCAAATCACAAGATATGCCAACATCAATGAGAGCTCCATGTTGAGTAGTGGAAAGGAGGTTGTCATGAGCTTCCTTAAGCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.80%	10.90%	4.30%	0.99%	NA
All Indica	2759	92.10%	3.70%	2.83%	1.38%	NA
All Japonica	1512	67.70%	24.70%	7.08%	0.60%	NA
Aus	269	98.90%	0.40%	0.74%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	88.40%	6.20%	3.44%	1.94%	NA
Indica III	913	90.00%	3.50%	4.05%	2.41%	NA
Indica Intermediate	786	91.00%	5.10%	3.05%	0.89%	NA
Temperate Japonica	767	74.40%	17.60%	7.95%	0.00%	NA
Tropical Japonica	504	63.50%	30.60%	4.56%	1.39%	NA
Japonica Intermediate	241	54.80%	34.90%	9.54%	0.83%	NA
VI/Aromatic	96	66.70%	25.00%	8.33%	0.00%	NA
Intermediate	90	73.30%	17.80%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0820513390	G -> A	LOC_Os08g33040.1	missense_variant ; p.Cys411Tyr; MODERATE	nonsynonymous_codon ; C411Y	Average:31.121; most accessible tissue: Minghui63 young leaf, score: 55.178	unknown	unknown	DELETERIOUS	0.02
vg0820513390	G -> DEL	LOC_Os08g33040.1	N	frameshift_variant	Average:31.121; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0820513390	NA	6.60E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	5.24E-06	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	1.28E-06	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	6.12E-09	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	3.02E-07	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	9.97E-06	mr1243	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	4.09E-10	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	2.02E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	3.36E-08	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	4.76E-07	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	5.64E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	7.27E-09	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	1.90E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	2.09E-07	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	3.93E-06	NA	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	7.39E-09	mr1089_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	2.37E-10	mr1093_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	3.34E-08	mr1227_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	1.96E-10	mr1235_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	1.52E-06	mr1243_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	5.07E-06	8.43E-06	mr1266_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	2.78E-06	2.78E-06	mr1356_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	1.87E-06	8.18E-08	mr1388_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	1.01E-07	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	4.64E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	6.27E-06	6.27E-06	mr1416_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	4.54E-06	mr1423_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	1.05E-07	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	6.54E-07	mr1554_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	4.55E-06	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	8.04E-10	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	2.00E-07	1.01E-08	mr1622_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	8.01E-06	mr1637_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	3.09E-07	mr1649_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	5.74E-06	4.37E-07	mr1762_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	1.91E-07	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	3.51E-06	mr1862_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	2.98E-07	mr1866_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	1.06E-06	mr1878_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	8.99E-06	mr1956_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820513390	NA	6.80E-09	mr1993_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251