Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0820434015:

Variant ID: vg0820434015 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20434015
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.06, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TAATAATGTTATTGTCAGTCCGCCCCTTAAAAAACGATAATTGCCAGTATATGATCTGTTTAATTTCCTTAACTTGAATTCTTAGTTGCATAGTGCAATA[A/G]
TTGTTTCAGTAATTAAATTAATAAATAGCTAGTTGACAATAGCACATCTCGATCGGTTTCACAAAGAAAAAAAGCATTTCTTACCTACATGTTTCTAAAC

Reverse complement sequence

GTTTAGAAACATGTAGGTAAGAAATGCTTTTTTTCTTTGTGAAACCGATCGAGATGTGCTATTGTCAACTAGCTATTTATTAATTTAATTACTGAAACAA[T/C]
TATTGCACTATGCAACTAAGAATTCAAGTTAAGGAAATTAAACAGATCATATACTGGCAATTATCGTTTTTTAAGGGGCGGACTGACAATAACATTATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.80% 0.06% 0.00% NA
All Indica  2759 92.00% 7.90% 0.11% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 28.60% 71.40% 0.00% 0.00% NA
Indica I  595 86.20% 13.60% 0.17% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 96.60% 3.30% 0.11% 0.00% NA
Indica Intermediate  786 87.80% 12.10% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820434015 A -> G LOC_Os08g32940.1 upstream_gene_variant ; 2978.0bp to feature; MODIFIER silent_mutation Average:39.025; most accessible tissue: Callus, score: 85.801 N N N N
vg0820434015 A -> G LOC_Os08g32940-LOC_Os08g32950 intergenic_region ; MODIFIER silent_mutation Average:39.025; most accessible tissue: Callus, score: 85.801 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820434015 NA 9.14E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 2.01E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 8.57E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 1.24E-08 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 1.11E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 1.52E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 1.38E-07 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 8.22E-10 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 1.17E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 3.08E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 6.27E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 2.87E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 4.00E-08 mr1444 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 8.74E-08 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 3.44E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 4.90E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 3.61E-08 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 8.19E-08 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 3.18E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 3.53E-11 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 4.60E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 5.98E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 2.53E-07 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820434015 NA 5.28E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251