\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820421110:

Variant ID: vg0820421110 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20421110
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, C: 0.05, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGGCACCTATAATATGTATAGGTGCCGGTTTTGTACCAATAATCGGCACCTATACCGACTTATAGGTGCCAATTATGGACCATCATGCCACGTGGCTG[C/G]
CCTTATATGTGTCGATTATTTACAACAACCGCCACTCAATAAATCAGATAAATCGAAGAAATTATAAGAAAAAAAGAAATACATCTAGCCATCGATTTTC

Reverse complement sequence

GAAAATCGATGGCTAGATGTATTTCTTTTTTTCTTATAATTTCTTCGATTTATCTGATTTATTGAGTGGCGGTTGTTGTAAATAATCGACACATATAAGG[G/C]
CAGCCACGTGGCATGATGGTCCATAATTGGCACCTATAAGTCGGTATAGGTGCCGATTATTGGTACAAAACCGGCACCTATACATATTATAGGTGCCGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 25.90% 0.15% 0.00% NA
All Indica  2759 91.60% 8.30% 0.11% 0.00% NA
All Japonica  1512 38.40% 61.40% 0.20% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 88.00% 12.00% 0.00% 0.00% NA
Indica III  913 89.60% 10.30% 0.11% 0.00% NA
Indica Intermediate  786 90.50% 9.40% 0.13% 0.00% NA
Temperate Japonica  767 33.20% 66.50% 0.26% 0.00% NA
Tropical Japonica  504 46.60% 53.20% 0.20% 0.00% NA
Japonica Intermediate  241 37.80% 62.20% 0.00% 0.00% NA
VI/Aromatic  96 65.60% 34.40% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820421110 C -> G LOC_Os08g32930.1 upstream_gene_variant ; 2629.0bp to feature; MODIFIER silent_mutation Average:34.963; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0820421110 C -> G LOC_Os08g32930.2 upstream_gene_variant ; 2624.0bp to feature; MODIFIER silent_mutation Average:34.963; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0820421110 C -> G LOC_Os08g32920.1 downstream_gene_variant ; 2383.0bp to feature; MODIFIER silent_mutation Average:34.963; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0820421110 C -> G LOC_Os08g32920-LOC_Os08g32930 intergenic_region ; MODIFIER silent_mutation Average:34.963; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820421110 NA 2.31E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 3.27E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 1.12E-08 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 1.24E-06 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 3.75E-06 mr1243 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 4.10E-09 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 3.26E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 6.80E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 5.12E-11 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 8.75E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 8.17E-09 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 4.41E-11 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 2.13E-07 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 5.10E-11 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 8.86E-07 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 3.63E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 5.87E-07 5.87E-07 mr1356_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 4.19E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 8.87E-06 1.76E-07 mr1388_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 4.13E-09 mr1403_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 7.01E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 1.28E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 8.13E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 7.16E-06 2.03E-07 mr1541_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 4.14E-07 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 3.76E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 2.64E-09 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 2.64E-07 7.97E-09 mr1622_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 9.39E-06 mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 5.19E-06 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 3.03E-06 mr1762_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 5.23E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 1.03E-06 mr1862_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 2.26E-07 mr1866_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 1.23E-06 mr1956_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820421110 NA 8.44E-09 mr1993_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251