\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820390658:

Variant ID: vg0820390658 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20390658
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTCTTCTGCAACAAGGCTTTCCCAGCAATTCAGGCAAGATGTCCAGCTGAACTGGAGGAGACGGGAAGAAAGATTGTCAGGGAGTGCCATGGCGTGCC[C/T]
CTGCTCGTTGTCACCATCGGTGGACTAATGTCGATGAAGGAACAAACAGTCCAGGTTTGGAAGAATGTGCTTGACAACTTGCACAAGAAGTACCTCCCTG

Reverse complement sequence

CAGGGAGGTACTTCTTGTGCAAGTTGTCAAGCACATTCTTCCAAACCTGGACTGTTTGTTCCTTCATCGACATTAGTCCACCGATGGTGACAACGAGCAG[G/A]
GGCACGCCATGGCACTCCCTGACAATCTTTCTTCCCGTCTCCTCCAGTTCAGCTGGACATCTTGCCTGAATTGCTGGGAAAGCCTTGTTGCAGAAGAGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.00% 44.30% 0.13% 0.55% NA
All Indica  2759 31.50% 67.80% 0.14% 0.51% NA
All Japonica  1512 87.70% 11.60% 0.07% 0.60% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 18.20% 81.30% 0.17% 0.34% NA
Indica II  465 19.60% 79.10% 0.22% 1.08% NA
Indica III  913 39.30% 60.40% 0.11% 0.22% NA
Indica Intermediate  786 39.70% 59.50% 0.13% 0.64% NA
Temperate Japonica  767 99.20% 0.40% 0.13% 0.26% NA
Tropical Japonica  504 67.50% 31.50% 0.00% 0.99% NA
Japonica Intermediate  241 93.40% 5.80% 0.00% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 64.40% 31.10% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820390658 C -> T LOC_Os08g32880.1 synonymous_variant ; p.Pro365Pro; LOW synonymous_codon Average:61.5; most accessible tissue: Callus, score: 71.364 N N N N
vg0820390658 C -> DEL LOC_Os08g32880.1 N frameshift_variant Average:61.5; most accessible tissue: Callus, score: 71.364 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820390658 NA 2.52E-07 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 2.12E-07 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 8.31E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 4.24E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 6.13E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 1.18E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 2.13E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 3.95E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 2.88E-09 mr1176 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 2.54E-07 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 3.14E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 4.84E-08 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 4.08E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 3.41E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 4.64E-10 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 5.50E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 7.24E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 1.18E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 1.62E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 6.58E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820390658 NA 3.27E-14 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251