Variant ID: vg0820314365 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 20314365 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACTTCTCAAGGCAGCTGTGCTCATGGTAAGTGAAAAAGTCGTTCATGTTTAATACTCTCTTCGTCTCTAAATATTTGACGCCGTTGATTTTTTAAAACAT[G/A]
TTTGATTGTTCGTCCTATTCAAAAACTTTTGTAAAATATGTAAAATTATATGTATACATAAAAGTATATTTAACAATGAATCAAATGATAGGAAAATAAT
ATTATTTTCCTATCATTTGATTCATTGTTAAATATACTTTTATGTATACATATAATTTTACATATTTTACAAAAGTTTTTGAATAGGACGAACAATCAAA[C/T]
ATGTTTTAAAAAATCAACGGCGTCAAATATTTAGAGACGAAGAGAGTATTAAACATGAACGACTTTTTCACTTACCATGAGCACAGCTGCCTTGAGAAGT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.70% | 6.10% | 0.21% | 0.00% | NA |
All Indica | 2759 | 92.10% | 7.60% | 0.29% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 72.90% | 26.40% | 0.74% | 0.00% | NA |
Indica I | 595 | 96.30% | 2.70% | 1.01% | 0.00% | NA |
Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 89.00% | 11.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 89.20% | 10.60% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0820314365 | G -> A | LOC_Os08g32780.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.055; most accessible tissue: Zhenshan97 flower, score: 74.708 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0820314365 | NA | 8.32E-08 | mr1171 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0820314365 | NA | 1.71E-06 | mr1171 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0820314365 | NA | 6.81E-06 | mr1500 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0820314365 | 5.40E-06 | NA | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0820314365 | NA | 3.18E-06 | mr1544 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0820314365 | NA | 4.79E-06 | mr1952 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0820314365 | NA | 2.05E-06 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |