\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820155733:

Variant ID: vg0820155733 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20155733
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, A: 0.10, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TTCACCAATCCATGTAAATATTCTGTGAATCAGAGCATGTCCTGCTGCACACATTGCTAGTACTACAATCCAGCAAGGACAACTGGACAAGCACAAATCT[A/C]
TCTCATTTTGTTTCCTTCACAGACTGGCAGTTCAGAACCTGCAGCCACTGGCATGATGACTCAACTGTACCAGTAGGGCTATCTACAAGAAGGTTAAAGG

Reverse complement sequence

CCTTTAACCTTCTTGTAGATAGCCCTACTGGTACAGTTGAGTCATCATGCCAGTGGCTGCAGGTTCTGAACTGCCAGTCTGTGAAGGAAACAAAATGAGA[T/G]
AGATTTGTGCTTGTCCAGTTGTCCTTGCTGGATTGTAGTACTAGCAATGTGTGCAGCAGGACATGCTCTGATTCACAGAATATTTACATGGATTGGTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 15.30% 0.17% 0.00% NA
All Indica  2759 91.40% 8.50% 0.11% 0.00% NA
All Japonica  1512 69.10% 30.60% 0.26% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 96.80% 3.20% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 88.40% 11.40% 0.22% 0.00% NA
Indica Intermediate  786 87.70% 12.20% 0.13% 0.00% NA
Temperate Japonica  767 46.70% 52.90% 0.39% 0.00% NA
Tropical Japonica  504 94.60% 5.40% 0.00% 0.00% NA
Japonica Intermediate  241 87.10% 12.40% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820155733 A -> C LOC_Os08g32530.1 downstream_gene_variant ; 3126.0bp to feature; MODIFIER silent_mutation Average:72.393; most accessible tissue: Callus, score: 88.865 N N N N
vg0820155733 A -> C LOC_Os08g32540.1 downstream_gene_variant ; 255.0bp to feature; MODIFIER silent_mutation Average:72.393; most accessible tissue: Callus, score: 88.865 N N N N
vg0820155733 A -> C LOC_Os08g32530-LOC_Os08g32540 intergenic_region ; MODIFIER silent_mutation Average:72.393; most accessible tissue: Callus, score: 88.865 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0820155733 A C 0.02 0.02 0.02 0.13 0.11 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820155733 NA 6.00E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 4.82E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 7.91E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 2.90E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 7.73E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 1.28E-06 1.27E-06 mr1207_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 1.40E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 3.25E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 4.71E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 4.03E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 9.61E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 2.98E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 1.35E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 6.71E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 2.57E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820155733 NA 2.94E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251