\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820146322:

Variant ID: vg0820146322 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 20146322
Reference Allele: TAlternative Allele: C,TTAGTTA,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, T: 0.37, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAATTTTTTAAGCCTAATTAATCCATAATTAGAGAATGTTTACTGTAACATCACATAGACTAATCATGGATTAATTAGACTCAATAGATTTATCTCTC[T/C,TTAGTTA,G]
AAGATTATATATGGGTTTTATTAATAGTCTACATTTAATATTTATAATTACAGTCCAAAACATCGTCCCGTCTAAACAGGTCTAAACACCCCAGCGGATT

Reverse complement sequence

AATCCGCTGGGGTGTTTAGACCTGTTTAGACGGGACGATGTTTTGGACTGTAATTATAAATATTAAATGTAGACTATTAATAAAACCCATATATAATCTT[A/G,TAACTAA,C]
GAGAGATAAATCTATTGAGTCTAATTAATCCATGATTAGTCTATGTGATGTTACAGTAAACATTCTCTAATTATGGATTAATTAGGCTTAAAAAATTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.10% 17.80% 13.97% 10.28% TTAGTTA: 4.57%; G: 0.21%
All Indica  2759 74.30% 2.10% 5.44% 10.26% TTAGTTA: 7.76%; G: 0.18%
All Japonica  1512 9.90% 48.50% 30.03% 11.44% G: 0.13%
Aus  269 96.70% 0.70% 0.37% 2.23% NA
Indica I  595 90.30% 0.70% 6.05% 0.67% TTAGTTA: 2.35%
Indica II  465 73.30% 3.40% 7.31% 13.55% TTAGTTA: 2.37%
Indica III  913 68.90% 2.00% 3.40% 14.02% TTAGTTA: 11.61%; G: 0.11%
Indica Intermediate  786 69.10% 2.40% 6.23% 11.20% TTAGTTA: 10.56%; G: 0.51%
Temperate Japonica  767 0.70% 62.80% 28.68% 7.56% G: 0.26%
Tropical Japonica  504 24.80% 33.30% 27.78% 14.09% NA
Japonica Intermediate  241 7.90% 34.90% 39.00% 18.26% NA
VI/Aromatic  96 16.70% 32.30% 33.33% 15.62% G: 2.08%
Intermediate  90 40.00% 21.10% 25.56% 10.00% TTAGTTA: 2.22%; G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820146322 T -> G LOC_Os08g32530.1 upstream_gene_variant ; 4982.0bp to feature; MODIFIER silent_mutation Average:63.791; most accessible tissue: Callus, score: 93.031 N N N N
vg0820146322 T -> G LOC_Os08g32520.1 downstream_gene_variant ; 775.0bp to feature; MODIFIER silent_mutation Average:63.791; most accessible tissue: Callus, score: 93.031 N N N N
vg0820146322 T -> G LOC_Os08g32520-LOC_Os08g32530 intergenic_region ; MODIFIER silent_mutation Average:63.791; most accessible tissue: Callus, score: 93.031 N N N N
vg0820146322 T -> C LOC_Os08g32530.1 upstream_gene_variant ; 4982.0bp to feature; MODIFIER silent_mutation Average:63.791; most accessible tissue: Callus, score: 93.031 N N N N
vg0820146322 T -> C LOC_Os08g32520.1 downstream_gene_variant ; 775.0bp to feature; MODIFIER silent_mutation Average:63.791; most accessible tissue: Callus, score: 93.031 N N N N
vg0820146322 T -> C LOC_Os08g32520-LOC_Os08g32530 intergenic_region ; MODIFIER silent_mutation Average:63.791; most accessible tissue: Callus, score: 93.031 N N N N
vg0820146322 T -> DEL N N silent_mutation Average:63.791; most accessible tissue: Callus, score: 93.031 N N N N
vg0820146322 T -> TTAGTTA LOC_Os08g32530.1 upstream_gene_variant ; 4981.0bp to feature; MODIFIER silent_mutation Average:63.791; most accessible tissue: Callus, score: 93.031 N N N N
vg0820146322 T -> TTAGTTA LOC_Os08g32520.1 downstream_gene_variant ; 776.0bp to feature; MODIFIER silent_mutation Average:63.791; most accessible tissue: Callus, score: 93.031 N N N N
vg0820146322 T -> TTAGTTA LOC_Os08g32520-LOC_Os08g32530 intergenic_region ; MODIFIER silent_mutation Average:63.791; most accessible tissue: Callus, score: 93.031 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0820146322 T C -0.03 -0.01 0.01 -0.04 -0.02 -0.02
vg0820146322 T G -0.01 0.0 0.01 -0.03 0.0 0.0
vg0820146322 T TTAGT* 0.52 0.36 0.22 -0.08 0.21 0.26

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820146322 NA 1.07E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 5.61E-31 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 2.28E-34 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 3.65E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 1.39E-06 NA mr1157 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 2.18E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 8.84E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 2.21E-21 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 2.08E-30 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 1.37E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 1.64E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 5.15E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 2.97E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 4.79E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 2.52E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 7.96E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 8.86E-06 NA mr1328 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 5.51E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 5.52E-16 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 1.06E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 3.78E-28 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 8.37E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 6.86E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 6.77E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 5.52E-16 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 1.21E-07 NA mr1446 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 6.94E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 9.99E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 3.93E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 2.08E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 8.94E-38 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 2.72E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 7.67E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 5.64E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 1.70E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 6.70E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 1.87E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 1.28E-15 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 4.34E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 5.83E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 NA 1.02E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820146322 9.42E-06 NA mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251