\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820053955:

Variant ID: vg0820053955 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20053955
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCCAACAACCATAACAGTCAGAAGTGGCAAAACTGCACGTTTTTGGAGCTCGAAGTGGCGGGGAAATCAAACTCCTCAAAGGATTGCACCCTAGATAT[C/T]
GACATCCTACGTATCACTGAGGCGGAGCACCTACAACAACTCGTCTGACTTTGGTCCATGATCAGAAGAATGAACCCCCTAAATGAGGAGCGAGACACGG

Reverse complement sequence

CCGTGTCTCGCTCCTCATTTAGGGGGTTCATTCTTCTGATCATGGACCAAAGTCAGACGAGTTGTTGTAGGTGCTCCGCCTCAGTGATACGTAGGATGTC[G/A]
ATATCTAGGGTGCAATCCTTTGAGGAGTTTGATTTCCCCGCCACTTCGAGCTCCAAAAACGTGCAGTTTTGCCACTTCTGACTGTTATGGTTGTTGGCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 33.20% 0.42% 0.00% NA
All Indica  2759 60.90% 38.40% 0.69% 0.00% NA
All Japonica  1512 89.20% 10.80% 0.00% 0.00% NA
Aus  269 2.60% 97.00% 0.37% 0.00% NA
Indica I  595 56.30% 43.70% 0.00% 0.00% NA
Indica II  465 78.70% 21.30% 0.00% 0.00% NA
Indica III  913 51.20% 47.30% 1.53% 0.00% NA
Indica Intermediate  786 65.10% 34.20% 0.64% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 73.80% 26.20% 0.00% 0.00% NA
Japonica Intermediate  241 87.60% 12.40% 0.00% 0.00% NA
VI/Aromatic  96 45.80% 54.20% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820053955 C -> T LOC_Os08g32380.1 upstream_gene_variant ; 1090.0bp to feature; MODIFIER silent_mutation Average:55.826; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0820053955 C -> T LOC_Os08g32370.1 downstream_gene_variant ; 1645.0bp to feature; MODIFIER silent_mutation Average:55.826; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0820053955 C -> T LOC_Os08g32370-LOC_Os08g32380 intergenic_region ; MODIFIER silent_mutation Average:55.826; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820053955 NA 2.52E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 NA 4.57E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 NA 5.20E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 NA 3.66E-06 mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 6.73E-06 1.34E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 NA 2.13E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 NA 7.48E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 NA 1.12E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 NA 2.23E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 8.65E-06 8.64E-06 mr1601 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 NA 8.97E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 NA 1.46E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 NA 1.73E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 7.05E-06 NA mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 9.67E-06 4.45E-06 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 1.70E-07 8.64E-09 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 3.52E-06 3.52E-06 mr1233_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 NA 1.28E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 1.24E-06 NA mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 NA 1.17E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820053955 1.09E-06 NA mr1949_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251