\
| Variant ID: vg0820053743 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 20053743 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 250. )
AGGAGGCGACTCCATCTCAGGAGGAAAATGCACTAGGAGAGAGTTTGCAGGCCAAAAGATCTGGGAGGATTGGGTGTCATGGACCTACAACGCTTTGCCA[C/T]
TGCGCTACGGCTCAAATGGCTCTAGTATGAGTGGGTAGCACCCGAGAAACGTTGGACAAGCACAGCCGTCCCATGCAGCAATCTTGACAGAGAACTCTTT
AAAGAGTTCTCTGTCAAGATTGCTGCATGGGACGGCTGTGCTTGTCCAACGTTTCTCGGGTGCTACCCACTCATACTAGAGCCATTTGAGCCGTAGCGCA[G/A]
TGGCAAAGCGTTGTAGGTCCATGACACCCAATCCTCCCAGATCTTTTGGCCTGCAAACTCTCTCCTAGTGCATTTTCCTCCTGAGATGGAGTCGCCTCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.60% | 30.30% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 66.00% | 33.90% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 4.10% | 95.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 56.00% | 43.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 55.80% | 44.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 71.50% | 28.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 49.00% | 50.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0820053743 | C -> T | LOC_Os08g32380.1 | upstream_gene_variant ; 1302.0bp to feature; MODIFIER | silent_mutation | Average:58.74; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0820053743 | C -> T | LOC_Os08g32370.1 | downstream_gene_variant ; 1433.0bp to feature; MODIFIER | silent_mutation | Average:58.74; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0820053743 | C -> T | LOC_Os08g32370-LOC_Os08g32380 | intergenic_region ; MODIFIER | silent_mutation | Average:58.74; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0820053743 | NA | 4.83E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820053743 | NA | 2.99E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820053743 | NA | 4.48E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820053743 | NA | 6.41E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820053743 | 1.06E-06 | 1.06E-06 | mr1601 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820053743 | NA | 1.61E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820053743 | 1.94E-06 | 6.92E-08 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820053743 | NA | 3.73E-07 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0820053743 | NA | 1.51E-06 | mr1620_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |