\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819873123:

Variant ID: vg0819873123 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19873123
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGATTCGATGCCTTAGGTCCTCCCAGGGGTCCCTTTTATACCACAGGTCAACTGGTCTCCAAGTAGGACTCGGAGACATCGGACCCGATACGATACAAT[G/A]
ACGACCCAATTCTATCCGAGTAGGACTCCTTACATCTGTGAACTCCATAATGAATTTCCTTAACTTATGCCGAAAACGTCCGTATGTGCGCAAGTATACC

Reverse complement sequence

GGTATACTTGCGCACATACGGACGTTTTCGGCATAAGTTAAGGAAATTCATTATGGAGTTCACAGATGTAAGGAGTCCTACTCGGATAGAATTGGGTCGT[C/T]
ATTGTATCGTATCGGGTCCGATGTCTCCGAGTCCTACTTGGAGACCAGTTGACCTGTGGTATAAAAGGGACCCCTGGGAGGACCTAAGGCATCGAATCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 5.20% 3.64% 5.25% NA
All Indica  2759 78.00% 7.80% 5.84% 8.45% NA
All Japonica  1512 99.80% 0.10% 0.07% 0.07% NA
Aus  269 89.20% 10.40% 0.00% 0.37% NA
Indica I  595 81.70% 16.80% 0.17% 1.34% NA
Indica II  465 92.90% 0.20% 3.01% 3.87% NA
Indica III  913 70.00% 3.60% 12.38% 14.02% NA
Indica Intermediate  786 75.60% 10.20% 4.20% 10.05% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 83.30% 0.00% 6.25% 10.42% NA
Intermediate  90 88.90% 3.30% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819873123 G -> A LOC_Os08g32030.1 upstream_gene_variant ; 3780.0bp to feature; MODIFIER silent_mutation Average:40.874; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0819873123 G -> A LOC_Os08g32040.1 upstream_gene_variant ; 2659.0bp to feature; MODIFIER silent_mutation Average:40.874; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0819873123 G -> A LOC_Os08g32050.1 upstream_gene_variant ; 589.0bp to feature; MODIFIER silent_mutation Average:40.874; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0819873123 G -> A LOC_Os08g32060.1 upstream_gene_variant ; 2143.0bp to feature; MODIFIER silent_mutation Average:40.874; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0819873123 G -> A LOC_Os08g32050-LOC_Os08g32060 intergenic_region ; MODIFIER silent_mutation Average:40.874; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0819873123 G -> DEL N N silent_mutation Average:40.874; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0819873123 G A 0.0 -0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819873123 4.14E-06 1.09E-06 mr1755 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819873123 NA 1.32E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819873123 NA 2.50E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819873123 NA 8.56E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819873123 NA 2.04E-06 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819873123 NA 6.27E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819873123 NA 1.15E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819873123 NA 2.94E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251