\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819763162:

Variant ID: vg0819763162 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19763162
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TCCATCCTCCTCAGCACGAAGCTCTCAAGCAGCAGGTAGCACCCAAACTTGTCCCACTGACCCGGCCTCGCCTCACGCCTCTCCCCCCTCTCGATACTCT[C/A]
CACGTCGCCATTACCGGCAACCCACCCTCCTCTCTCCAGCTCCCACTTCATCTTCTCCCACACCACCATGTCCAGCCCAACTCCACCTGCCGTGCCAGAG

Reverse complement sequence

CTCTGGCACGGCAGGTGGAGTTGGGCTGGACATGGTGGTGTGGGAGAAGATGAAGTGGGAGCTGGAGAGAGGAGGGTGGGTTGCCGGTAATGGCGACGTG[G/T]
AGAGTATCGAGAGGGGGGAGAGGCGTGAGGCGAGGCCGGGTCAGTGGGACAAGTTTGGGTGCTACCTGCTGCTTGAGAGCTTCGTGCTGAGGAGGATGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.70% 28.20% 0.13% 0.00% NA
All Indica  2759 56.70% 43.10% 0.18% 0.00% NA
All Japonica  1512 91.30% 8.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 43.40% 56.00% 0.67% 0.00% NA
Indica II  465 24.10% 75.70% 0.22% 0.00% NA
Indica III  913 80.80% 19.20% 0.00% 0.00% NA
Indica Intermediate  786 58.10% 41.90% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 77.80% 22.00% 0.20% 0.00% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819763162 C -> A LOC_Os08g31880.1 stop_gained ; p.Glu356*; HIGH stop_gained Average:73.402; most accessible tissue: Minghui63 root, score: 89.689 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0819763162 C A 0.39 0.25 0.12 0.1 0.17 0.12

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819763162 NA 1.01E-07 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819763162 NA 1.03E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819763162 NA 6.87E-07 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819763162 NA 6.51E-09 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819763162 NA 2.62E-06 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819763162 NA 5.34E-08 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819763162 NA 2.44E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819763162 NA 3.75E-08 mr1561_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819763162 NA 9.59E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819763162 NA 5.25E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819763162 NA 1.56E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819763162 NA 6.74E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819763162 NA 2.90E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251