Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0819756278:

Variant ID: vg0819756278 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19756278
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGTCATTACATTTGTAGCCGTTGCAAACTTGTTGCATTGTAGTCATCCTCTACAAATACAAAAACTACTCAGTAAATTACTCTACATTTCATCAAACTA[G/C]
ATTGATCACCCCAACAGAGGTTTTATGCACATGTTAAACCAGGGCTCCCGAGCCAAACTTCTTAAAATATTAGCCAAAACTCCACTCATACACAATTCCC

Reverse complement sequence

GGGAATTGTGTATGAGTGGAGTTTTGGCTAATATTTTAAGAAGTTTGGCTCGGGAGCCCTGGTTTAACATGTGCATAAAACCTCTGTTGGGGTGATCAAT[C/G]
TAGTTTGATGAAATGTAGAGTAATTTACTGAGTAGTTTTTGTATTTGTAGAGGATGACTACAATGCAACAAGTTTGCAACGGCTACAAATGTAATGACTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.60%	23.30%	0.04%	0.00%	NA
All Indica	2759	72.70%	27.20%	0.07%	0.00%	NA
All Japonica	1512	99.20%	0.80%	0.00%	0.00%	NA
Aus	269	4.50%	95.50%	0.00%	0.00%	NA
Indica I	595	76.80%	23.00%	0.17%	0.00%	NA
Indica II	465	93.50%	6.50%	0.00%	0.00%	NA
Indica III	913	58.20%	41.70%	0.11%	0.00%	NA
Indica Intermediate	786	74.20%	25.80%	0.00%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.90%	0.00%	0.00%	NA
VI/Aromatic	96	42.70%	57.30%	0.00%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819756278	G -> C	LOC_Os08g31870.1	downstream_gene_variant ; 523.0bp to feature; MODIFIER	silent_mutation	Average:42.159; most accessible tissue: Callus, score: 79.742	N	N	N	N
vg0819756278	G -> C	LOC_Os08g31860-LOC_Os08g31870	intergenic_region ; MODIFIER	silent_mutation	Average:42.159; most accessible tissue: Callus, score: 79.742	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819756278	NA	1.77E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819756278	NA	2.34E-13	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819756278	NA	1.27E-09	mr1192	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819756278	NA	2.52E-08	mr1192	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819756278	NA	1.02E-06	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819756278	NA	5.93E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819756278	NA	4.22E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819756278	NA	2.67E-17	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819756278	NA	3.58E-06	mr1857	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819756278	NA	3.03E-20	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819756278	4.07E-06	3.19E-06	mr1961	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819756278	NA	1.36E-08	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819756278	NA	8.85E-07	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819756278	NA	7.22E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251