Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0819689109:

Variant ID: vg0819689109 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19689109
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTGAAAGAAATTATTATGTTATAAATGTGAGCATAATATTAACAAATATTAATAGAACTTTTACTAAGACAAGCGTGCTATAAGAGAGTTTAACCCTCT[T/C]
TTTTTTCCCAATTCCATAGTTTGGGTTTTCGTTTGCACGCTTTCCAAGTTTCTAAATGGTGTCTTTTTTAAACAACAGTTTAGCTTTTTAGAAGTCAATT

Reverse complement sequence

AATTGACTTCTAAAAAGCTAAACTGTTGTTTAAAAAAGACACCATTTAGAAACTTGGAAAGCGTGCAAACGAAAACCCAAACTATGGAATTGGGAAAAAA[A/G]
AGAGGGTTAAACTCTCTTATAGCACGCTTGTCTTAGTAAAAGTTCTATTAATATTTGTTAATATTATGCTCACATTTATAACATAATAATTTCTTTCACC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.30%	2.80%	17.05%	47.88%	NA
All Indica	2759	14.30%	4.70%	23.49%	57.52%	NA
All Japonica	1512	69.20%	0.10%	4.96%	25.73%	NA
Aus	269	17.10%	0.00%	14.50%	68.40%	NA
Indica I	595	17.80%	7.20%	22.69%	52.27%	NA
Indica II	465	10.80%	7.70%	25.81%	55.70%	NA
Indica III	913	15.90%	1.80%	22.23%	60.13%	NA
Indica Intermediate	786	11.80%	4.50%	24.17%	59.54%	NA
Temperate Japonica	767	82.00%	0.10%	0.78%	17.08%	NA
Tropical Japonica	504	47.80%	0.00%	11.51%	40.67%	NA
Japonica Intermediate	241	73.40%	0.00%	4.56%	21.99%	NA
VI/Aromatic	96	10.40%	0.00%	26.04%	63.54%	NA
Intermediate	90	31.10%	1.10%	21.11%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819689109	T -> C	LOC_Os08g31769.1	upstream_gene_variant ; 4337.0bp to feature; MODIFIER	silent_mutation	Average:4.799; most accessible tissue: Callus, score: 8.122	N	N	N	N
vg0819689109	T -> C	LOC_Os08g31769.2	upstream_gene_variant ; 4337.0bp to feature; MODIFIER	silent_mutation	Average:4.799; most accessible tissue: Callus, score: 8.122	N	N	N	N
vg0819689109	T -> C	LOC_Os08g31760.1	downstream_gene_variant ; 3849.0bp to feature; MODIFIER	silent_mutation	Average:4.799; most accessible tissue: Callus, score: 8.122	N	N	N	N
vg0819689109	T -> C	LOC_Os08g31760-LOC_Os08g31769	intergenic_region ; MODIFIER	silent_mutation	Average:4.799; most accessible tissue: Callus, score: 8.122	N	N	N	N
vg0819689109	T -> DEL	N	N	silent_mutation	Average:4.799; most accessible tissue: Callus, score: 8.122	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819689109	1.37E-08	3.24E-18	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819689109	1.56E-08	6.40E-14	mr1191	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819689109	1.04E-06	1.44E-17	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819689109	9.23E-06	9.37E-13	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819689109	8.09E-08	2.47E-28	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819689109	3.56E-07	6.17E-20	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251