\
| Variant ID: vg0819689109 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19689109 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGTGAAAGAAATTATTATGTTATAAATGTGAGCATAATATTAACAAATATTAATAGAACTTTTACTAAGACAAGCGTGCTATAAGAGAGTTTAACCCTCT[T/C]
TTTTTTCCCAATTCCATAGTTTGGGTTTTCGTTTGCACGCTTTCCAAGTTTCTAAATGGTGTCTTTTTTAAACAACAGTTTAGCTTTTTAGAAGTCAATT
AATTGACTTCTAAAAAGCTAAACTGTTGTTTAAAAAAGACACCATTTAGAAACTTGGAAAGCGTGCAAACGAAAACCCAAACTATGGAATTGGGAAAAAA[A/G]
AGAGGGTTAAACTCTCTTATAGCACGCTTGTCTTAGTAAAAGTTCTATTAATATTTGTTAATATTATGCTCACATTTATAACATAATAATTTCTTTCACC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.30% | 2.80% | 17.05% | 47.88% | NA |
| All Indica | 2759 | 14.30% | 4.70% | 23.49% | 57.52% | NA |
| All Japonica | 1512 | 69.20% | 0.10% | 4.96% | 25.73% | NA |
| Aus | 269 | 17.10% | 0.00% | 14.50% | 68.40% | NA |
| Indica I | 595 | 17.80% | 7.20% | 22.69% | 52.27% | NA |
| Indica II | 465 | 10.80% | 7.70% | 25.81% | 55.70% | NA |
| Indica III | 913 | 15.90% | 1.80% | 22.23% | 60.13% | NA |
| Indica Intermediate | 786 | 11.80% | 4.50% | 24.17% | 59.54% | NA |
| Temperate Japonica | 767 | 82.00% | 0.10% | 0.78% | 17.08% | NA |
| Tropical Japonica | 504 | 47.80% | 0.00% | 11.51% | 40.67% | NA |
| Japonica Intermediate | 241 | 73.40% | 0.00% | 4.56% | 21.99% | NA |
| VI/Aromatic | 96 | 10.40% | 0.00% | 26.04% | 63.54% | NA |
| Intermediate | 90 | 31.10% | 1.10% | 21.11% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819689109 | T -> C | LOC_Os08g31769.1 | upstream_gene_variant ; 4337.0bp to feature; MODIFIER | silent_mutation | Average:4.799; most accessible tissue: Callus, score: 8.122 | N | N | N | N |
| vg0819689109 | T -> C | LOC_Os08g31769.2 | upstream_gene_variant ; 4337.0bp to feature; MODIFIER | silent_mutation | Average:4.799; most accessible tissue: Callus, score: 8.122 | N | N | N | N |
| vg0819689109 | T -> C | LOC_Os08g31760.1 | downstream_gene_variant ; 3849.0bp to feature; MODIFIER | silent_mutation | Average:4.799; most accessible tissue: Callus, score: 8.122 | N | N | N | N |
| vg0819689109 | T -> C | LOC_Os08g31760-LOC_Os08g31769 | intergenic_region ; MODIFIER | silent_mutation | Average:4.799; most accessible tissue: Callus, score: 8.122 | N | N | N | N |
| vg0819689109 | T -> DEL | N | N | silent_mutation | Average:4.799; most accessible tissue: Callus, score: 8.122 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819689109 | 1.37E-08 | 3.24E-18 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819689109 | 1.56E-08 | 6.40E-14 | mr1191 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819689109 | 1.04E-06 | 1.44E-17 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819689109 | 9.23E-06 | 9.37E-13 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819689109 | 8.09E-08 | 2.47E-28 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819689109 | 3.56E-07 | 6.17E-20 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |