\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819689109:

Variant ID: vg0819689109 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19689109
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTGAAAGAAATTATTATGTTATAAATGTGAGCATAATATTAACAAATATTAATAGAACTTTTACTAAGACAAGCGTGCTATAAGAGAGTTTAACCCTCT[T/C]
TTTTTTCCCAATTCCATAGTTTGGGTTTTCGTTTGCACGCTTTCCAAGTTTCTAAATGGTGTCTTTTTTAAACAACAGTTTAGCTTTTTAGAAGTCAATT

Reverse complement sequence

AATTGACTTCTAAAAAGCTAAACTGTTGTTTAAAAAAGACACCATTTAGAAACTTGGAAAGCGTGCAAACGAAAACCCAAACTATGGAATTGGGAAAAAA[A/G]
AGAGGGTTAAACTCTCTTATAGCACGCTTGTCTTAGTAAAAGTTCTATTAATATTTGTTAATATTATGCTCACATTTATAACATAATAATTTCTTTCACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.30% 2.80% 17.05% 47.88% NA
All Indica  2759 14.30% 4.70% 23.49% 57.52% NA
All Japonica  1512 69.20% 0.10% 4.96% 25.73% NA
Aus  269 17.10% 0.00% 14.50% 68.40% NA
Indica I  595 17.80% 7.20% 22.69% 52.27% NA
Indica II  465 10.80% 7.70% 25.81% 55.70% NA
Indica III  913 15.90% 1.80% 22.23% 60.13% NA
Indica Intermediate  786 11.80% 4.50% 24.17% 59.54% NA
Temperate Japonica  767 82.00% 0.10% 0.78% 17.08% NA
Tropical Japonica  504 47.80% 0.00% 11.51% 40.67% NA
Japonica Intermediate  241 73.40% 0.00% 4.56% 21.99% NA
VI/Aromatic  96 10.40% 0.00% 26.04% 63.54% NA
Intermediate  90 31.10% 1.10% 21.11% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819689109 T -> C LOC_Os08g31769.1 upstream_gene_variant ; 4337.0bp to feature; MODIFIER silent_mutation Average:4.799; most accessible tissue: Callus, score: 8.122 N N N N
vg0819689109 T -> C LOC_Os08g31769.2 upstream_gene_variant ; 4337.0bp to feature; MODIFIER silent_mutation Average:4.799; most accessible tissue: Callus, score: 8.122 N N N N
vg0819689109 T -> C LOC_Os08g31760.1 downstream_gene_variant ; 3849.0bp to feature; MODIFIER silent_mutation Average:4.799; most accessible tissue: Callus, score: 8.122 N N N N
vg0819689109 T -> C LOC_Os08g31760-LOC_Os08g31769 intergenic_region ; MODIFIER silent_mutation Average:4.799; most accessible tissue: Callus, score: 8.122 N N N N
vg0819689109 T -> DEL N N silent_mutation Average:4.799; most accessible tissue: Callus, score: 8.122 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819689109 1.37E-08 3.24E-18 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819689109 1.56E-08 6.40E-14 mr1191 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819689109 1.04E-06 1.44E-17 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819689109 9.23E-06 9.37E-13 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819689109 8.09E-08 2.47E-28 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819689109 3.56E-07 6.17E-20 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251