\
| Variant ID: vg0819592476 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19592476 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAATTATTCGGACGCGACTCCGGGTCGGGCGCCCGATAAGAGGAGGTTAAAATTGGGCGCTGACGTCAGCGCCTGATTTACATGCAAAACTACTTTAAAC[A/T]
GATTTTTCTCTTAAATTACTTATCCAAATCATGATCTGATTGCACCATTAAATTCGTTGCAATTAAATCTTCAAAACAAGACCACACATGAATATATTCT
AGAATATATTCATGTGTGGTCTTGTTTTGAAGATTTAATTGCAACGAATTTAATGGTGCAATCAGATCATGATTTGGATAAGTAATTTAAGAGAAAAATC[T/A]
GTTTAAAGTAGTTTTGCATGTAAATCAGGCGCTGACGTCAGCGCCCAATTTTAACCTCCTCTTATCGGGCGCCCGACCCGGAGTCGCGTCCGAATAATTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.50% | 26.40% | 0.02% | 0.02% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.00% | 0.04% | NA |
| All Japonica | 1512 | 26.60% | 73.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 17.60% | 82.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 24.60% | 75.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 59.30% | 40.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 58.30% | 41.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 41.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819592476 | A -> T | LOC_Os08g31649.1 | downstream_gene_variant ; 2959.0bp to feature; MODIFIER | silent_mutation | Average:35.138; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0819592476 | A -> T | LOC_Os08g31630-LOC_Os08g31649 | intergenic_region ; MODIFIER | silent_mutation | Average:35.138; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0819592476 | A -> DEL | N | N | silent_mutation | Average:35.138; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819592476 | NA | 7.51E-15 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | 7.69E-08 | NA | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | NA | 4.01E-07 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | 2.55E-06 | NA | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | NA | 1.41E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | 4.04E-06 | NA | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | 8.13E-06 | NA | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | NA | 4.56E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | 2.94E-06 | NA | mr1858 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | 2.88E-06 | NA | mr1859 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | 1.37E-07 | NA | mr1936 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | NA | 7.03E-17 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | 1.12E-06 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | NA | 1.76E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | 2.11E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | NA | 6.62E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | 3.97E-06 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | 4.63E-07 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | NA | 3.24E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | NA | 3.99E-07 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | 7.26E-06 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | NA | 8.94E-15 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | NA | 4.00E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819592476 | 8.39E-06 | NA | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |