\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819424621:

Variant ID: vg0819424621 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19424621
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATGAGTTAGAGCATGAGGTGGAACACGAGTGAACATGCTCGTGCTTTCTAGCAATTTATTATATACTAAAAGCCCATTAAACTTCCTACAAACGCTCT[C/T]
AAGCCGCCACGTGGGATTCCTATAAACGTCCTAAACCACCACGTGGCATTCTAATAAATTTTGAGAAAAAAGAAAAATATCTAACCGTTTATTTTTATTT

Reverse complement sequence

AAATAAAAATAAACGGTTAGATATTTTTCTTTTTTCTCAAAATTTATTAGAATGCCACGTGGTGGTTTAGGACGTTTATAGGAATCCCACGTGGCGGCTT[G/A]
AGAGCGTTTGTAGGAAGTTTAATGGGCTTTTAGTATATAATAAATTGCTAGAAAGCACGAGCATGTTCACTCGTGTTCCACCTCATGCTCTAACTCATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 7.20% 0.00% 0.00% NA
All Indica  2759 94.30% 5.70% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 39.40% 60.60% 0.00% 0.00% NA
Indica I  595 90.40% 9.60% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 90.30% 9.70% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819424621 C -> T LOC_Os08g31410.1 upstream_gene_variant ; 2834.0bp to feature; MODIFIER silent_mutation Average:48.408; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0819424621 C -> T LOC_Os08g31410.7 upstream_gene_variant ; 2802.0bp to feature; MODIFIER silent_mutation Average:48.408; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0819424621 C -> T LOC_Os08g31410.4 upstream_gene_variant ; 2821.0bp to feature; MODIFIER silent_mutation Average:48.408; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0819424621 C -> T LOC_Os08g31410.5 upstream_gene_variant ; 2821.0bp to feature; MODIFIER silent_mutation Average:48.408; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0819424621 C -> T LOC_Os08g31410.6 upstream_gene_variant ; 2821.0bp to feature; MODIFIER silent_mutation Average:48.408; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0819424621 C -> T LOC_Os08g31410.3 upstream_gene_variant ; 2825.0bp to feature; MODIFIER silent_mutation Average:48.408; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0819424621 C -> T LOC_Os08g31410.2 upstream_gene_variant ; 2834.0bp to feature; MODIFIER silent_mutation Average:48.408; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0819424621 C -> T LOC_Os08g31400-LOC_Os08g31410 intergenic_region ; MODIFIER silent_mutation Average:48.408; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819424621 NA 7.00E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819424621 4.36E-06 NA mr1304_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819424621 NA 6.92E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251