Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819407444:

Variant ID: vg0819407444 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19407444
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGCTTTTCGTCGAATTCAGATGTCAGCTCAGCTCTTATCGACGCCGGATCTTGGCTTCAAGGCGTGCATCTTTCTCCGACTTGTTGGAAGTCCGCTTCT[A/T]
GTACTGCCACGCGTAGTCTGGAAATCCATACTTCCAGGGAACATAAGACCCAATGCCCCGTGTCCGTCCACGGTGTTCCTTATTGCCCAACGCTTTCGTG

Reverse complement sequence

CACGAAAGCGTTGGGCAATAAGGAACACCGTGGACGGACACGGGGCATTGGGTCTTATGTTCCCTGGAAGTATGGATTTCCAGACTACGCGTGGCAGTAC[T/A]
AGAAGCGGACTTCCAACAAGTCGGAGAAAGATGCACGCCTTGAAGCCAAGATCCGGCGTCGATAAGAGCTGAGCTGACATCTGAATTCGACGAAAAGCTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.10%	24.00%	24.78%	20.08%	NA
All Indica	2759	3.50%	30.00%	33.49%	33.02%	NA
All Japonica	1512	81.80%	4.40%	12.24%	1.59%	NA
Aus	269	7.10%	78.10%	14.87%	0.00%	NA
Indica I	595	3.70%	24.40%	22.18%	49.75%	NA
Indica II	465	3.00%	21.70%	27.96%	47.31%	NA
Indica III	913	3.80%	38.30%	39.87%	17.96%	NA
Indica Intermediate	786	3.30%	29.40%	37.91%	29.39%	NA
Temperate Japonica	767	99.20%	0.10%	0.26%	0.39%	NA
Tropical Japonica	504	53.20%	11.50%	32.34%	2.98%	NA
Japonica Intermediate	241	86.30%	2.90%	8.30%	2.49%	NA
VI/Aromatic	96	77.10%	20.80%	2.08%	0.00%	NA
Intermediate	90	47.80%	14.40%	22.22%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819407444	A -> T	LOC_Os08g31380.1	upstream_gene_variant ; 2214.0bp to feature; MODIFIER	silent_mutation	Average:21.328; most accessible tissue: Zhenshan97 flag leaf, score: 30.355	N	N	N	N
vg0819407444	A -> T	LOC_Os08g31400.1	downstream_gene_variant ; 3872.0bp to feature; MODIFIER	silent_mutation	Average:21.328; most accessible tissue: Zhenshan97 flag leaf, score: 30.355	N	N	N	N
vg0819407444	A -> T	LOC_Os08g31390.1	intron_variant ; MODIFIER	silent_mutation	Average:21.328; most accessible tissue: Zhenshan97 flag leaf, score: 30.355	N	N	N	N
vg0819407444	A -> DEL	N	N	silent_mutation	Average:21.328; most accessible tissue: Zhenshan97 flag leaf, score: 30.355	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819407444	NA	1.78E-11	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	6.37E-11	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	5.59E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	2.67E-22	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	2.55E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	1.44E-10	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	7.72E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	1.87E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	9.45E-16	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	1.83E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	4.35E-06	mr1407	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	8.19E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	9.45E-16	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	2.54E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	2.82E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	1.92E-06	NA	mr1640	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	8.90E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	9.86E-06	mr1773	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	1.10E-20	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	5.28E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	1.15E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	2.25E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	3.06E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	6.35E-08	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819407444	NA	7.57E-14	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251