Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819366916:

Variant ID: vg0819366916 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19366916
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, C: 0.02, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

TCAATTTTTCAAGCCAGCTCTTGGCATCTTATATTTTAGTCCTAATGTGTTTTCAATTTACATAAAGTCCAAAATTTAGCACTACACACCCTAAAATCCC[A/C]
AAAAAAAAATTATCTCTCCTCCACTCTCCTCAATCTATCAATGGCGGCCAGTGGCAAACAAGCTCCAGCCGACGGAGGCCGGCGATTCCTCGACATCCTC

Reverse complement sequence

GAGGATGTCGAGGAATCGCCGGCCTCCGTCGGCTGGAGCTTGTTTGCCACTGGCCGCCATTGATAGATTGAGGAGAGTGGAGGAGAGATAATTTTTTTTT[T/G]
GGGATTTTAGGGTGTGTAGTGCTAAATTTTGGACTTTATGTAAATTGAAAACACATTAGGACTAAAATATAAGATGCCAAGAGCTGGCTTGAAAAATTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.20%	38.40%	1.46%	0.00%	NA
All Indica	2759	44.40%	54.90%	0.72%	0.00%	NA
All Japonica	1512	82.50%	14.50%	3.04%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	20.30%	79.00%	0.67%	0.00%	NA
Indica II	465	13.30%	86.20%	0.43%	0.00%	NA
Indica III	913	70.10%	29.60%	0.33%	0.00%	NA
Indica Intermediate	786	51.10%	47.50%	1.40%	0.00%	NA
Temperate Japonica	767	87.50%	8.10%	4.43%	0.00%	NA
Tropical Japonica	504	86.10%	12.90%	0.99%	0.00%	NA
Japonica Intermediate	241	58.90%	38.20%	2.90%	0.00%	NA
VI/Aromatic	96	64.60%	35.40%	0.00%	0.00%	NA
Intermediate	90	53.30%	43.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819366916	A -> C	LOC_Os08g31300.1	upstream_gene_variant ; 1970.0bp to feature; MODIFIER	silent_mutation	Average:59.58; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N
vg0819366916	A -> C	LOC_Os08g31320.1	upstream_gene_variant ; 4696.0bp to feature; MODIFIER	silent_mutation	Average:59.58; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N
vg0819366916	A -> C	LOC_Os08g31310.1	downstream_gene_variant ; 2431.0bp to feature; MODIFIER	silent_mutation	Average:59.58; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N
vg0819366916	A -> C	LOC_Os08g31300-LOC_Os08g31310	intergenic_region ; MODIFIER	silent_mutation	Average:59.58; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819366916	NA	2.69E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	5.36E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	7.26E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	1.20E-06	4.33E-08	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	3.59E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	6.16E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	6.84E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	4.30E-07	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	1.64E-16	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	8.70E-06	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	6.11E-07	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	1.90E-06	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	4.63E-08	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	2.13E-06	7.02E-08	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	1.09E-07	1.92E-09	mr1114_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	2.68E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	4.42E-08	6.04E-10	mr1117_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	2.72E-07	1.42E-09	mr1118_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	9.07E-07	5.63E-09	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	4.36E-07	1.68E-08	mr1120_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	6.18E-08	2.35E-09	mr1123_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	7.73E-06	mr1150_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	3.89E-08	2.26E-10	mr1240_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	6.77E-07	8.27E-09	mr1242_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	2.20E-06	2.59E-08	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	9.24E-19	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	5.17E-10	mr1352_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	4.34E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	3.99E-08	2.12E-10	mr1496_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	1.69E-07	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	6.28E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	4.07E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	2.35E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	1.40E-07	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	5.91E-11	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	5.21E-19	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	5.91E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	3.41E-06	3.56E-07	mr1936_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	NA	6.70E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819366916	6.21E-07	1.75E-08	mr1961_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251