Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0818736737:

Variant ID: vg0818736737 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18736737
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

CCAGTTACATACTACAGTTGTACGCGTCGAGTATTTGAGTATAAGTACGGTACACGCTTACTGTTGATTGTAGGCACACATAGTGAAGTCCTTGTCTTGA[T/C]
GGGCAAATAAGCAGTCCTTGATATAGCCCACTATGTTTGCTCGATCGTTTTTCAGCGTTGTCTCATTGATGACAGCTGGATCGAGTAAGGCAACATGGGG

Reverse complement sequence

CCCCATGTTGCCTTACTCGATCCAGCTGTCATCAATGAGACAACGCTGAAAAACGATCGAGCAAACATAGTGGGCTATATCAAGGACTGCTTATTTGCCC[A/G]
TCAAGACAAGGACTTCACTATGTGTGCCTACAATCAACAGTAAGCGTGTACCGTACTTATACTCAAATACTCGACGCGTACAACTGTAGTATGTAACTGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.30%	35.20%	0.49%	15.04%	NA
All Indica	2759	72.00%	7.70%	0.62%	19.68%	NA
All Japonica	1512	2.00%	86.90%	0.40%	10.71%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	77.60%	17.30%	0.00%	5.04%	NA
Indica II	465	88.40%	4.10%	0.86%	6.67%	NA
Indica III	913	68.10%	0.90%	0.99%	30.01%	NA
Indica Intermediate	786	62.50%	10.60%	0.51%	26.46%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	4.20%	65.50%	1.19%	29.17%	NA
Japonica Intermediate	241	2.10%	91.70%	0.00%	6.22%	NA
VI/Aromatic	96	11.50%	87.50%	0.00%	1.04%	NA
Intermediate	90	38.90%	55.60%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818736737	T -> C	LOC_Os08g30440.1	missense_variant ; p.His122Arg; MODERATE	nonsynonymous_codon ; H122C	Average:47.316; most accessible tissue: Minghui63 flag leaf, score: 64.867	benign	0.034	TOLERATED	0.14
vg0818736737	T -> C	LOC_Os08g30440.1	missense_variant ; p.His122Arg; MODERATE	nonsynonymous_codon ; H122R	Average:47.316; most accessible tissue: Minghui63 flag leaf, score: 64.867	benign	-0.442	TOLERATED	1.00
vg0818736737	T -> DEL	LOC_Os08g30440.1	N	frameshift_variant	Average:47.316; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818736737	NA	3.60E-13	mr1322	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	8.87E-08	mr1322	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	9.81E-17	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	5.50E-13	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	3.64E-07	mr1325	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	1.63E-14	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	8.99E-08	mr1326	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	9.12E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	2.77E-09	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	8.38E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	7.29E-09	mr1532	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	1.92E-06	mr1532	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	3.20E-14	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	4.47E-11	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	3.15E-06	3.15E-06	mr1623	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	5.79E-09	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	6.96E-06	3.69E-10	mr1690	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	9.87E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	9.86E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737	NA	1.78E-13	mr1553_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251