\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818736737:

Variant ID: vg0818736737 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18736737
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGTTACATACTACAGTTGTACGCGTCGAGTATTTGAGTATAAGTACGGTACACGCTTACTGTTGATTGTAGGCACACATAGTGAAGTCCTTGTCTTGA[T/C]
GGGCAAATAAGCAGTCCTTGATATAGCCCACTATGTTTGCTCGATCGTTTTTCAGCGTTGTCTCATTGATGACAGCTGGATCGAGTAAGGCAACATGGGG

Reverse complement sequence

CCCCATGTTGCCTTACTCGATCCAGCTGTCATCAATGAGACAACGCTGAAAAACGATCGAGCAAACATAGTGGGCTATATCAAGGACTGCTTATTTGCCC[A/G]
TCAAGACAAGGACTTCACTATGTGTGCCTACAATCAACAGTAAGCGTGTACCGTACTTATACTCAAATACTCGACGCGTACAACTGTAGTATGTAACTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 35.20% 0.49% 15.04% NA
All Indica  2759 72.00% 7.70% 0.62% 19.68% NA
All Japonica  1512 2.00% 86.90% 0.40% 10.71% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 77.60% 17.30% 0.00% 5.04% NA
Indica II  465 88.40% 4.10% 0.86% 6.67% NA
Indica III  913 68.10% 0.90% 0.99% 30.01% NA
Indica Intermediate  786 62.50% 10.60% 0.51% 26.46% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 4.20% 65.50% 1.19% 29.17% NA
Japonica Intermediate  241 2.10% 91.70% 0.00% 6.22% NA
VI/Aromatic  96 11.50% 87.50% 0.00% 1.04% NA
Intermediate  90 38.90% 55.60% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818736737 T -> C LOC_Os08g30440.1 missense_variant ; p.His122Arg; MODERATE nonsynonymous_codon ; H122C Average:47.316; most accessible tissue: Minghui63 flag leaf, score: 64.867 benign 0.034 TOLERATED 0.14
vg0818736737 T -> C LOC_Os08g30440.1 missense_variant ; p.His122Arg; MODERATE nonsynonymous_codon ; H122R Average:47.316; most accessible tissue: Minghui63 flag leaf, score: 64.867 benign -0.442 TOLERATED 1.00
vg0818736737 T -> DEL LOC_Os08g30440.1 N frameshift_variant Average:47.316; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818736737 NA 3.60E-13 mr1322 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 8.87E-08 mr1322 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 9.81E-17 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 5.50E-13 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 3.64E-07 mr1325 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 1.63E-14 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 8.99E-08 mr1326 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 9.12E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 2.77E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 8.38E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 7.29E-09 mr1532 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 1.92E-06 mr1532 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 3.20E-14 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 4.47E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 3.15E-06 3.15E-06 mr1623 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 5.79E-09 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 6.96E-06 3.69E-10 mr1690 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 9.87E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 9.86E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818736737 NA 1.78E-13 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251