Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818613813:

Variant ID: vg0818613813 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18613813
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GCAAACCAACTATCATGCCCTCCAATCAAGCTGGGTTTGCTTTCTCCTATGTCTGCCTATCTGCCTGCCAAACGAAAACGTGCAACCTTTTCGCGACATG[T/C]
TCACATGTACTACAGTTACACTTCGTAGATCATGAGTTCGCTTTTGAGAGTGGGTGGCATTGGGAGAGACACACCGCCACATTTTCCTCAAAGGTAGATT

Reverse complement sequence

AATCTACCTTTGAGGAAAATGTGGCGGTGTGTCTCTCCCAATGCCACCCACTCTCAAAAGCGAACTCATGATCTACGAAGTGTAACTGTAGTACATGTGA[A/G]
CATGTCGCGAAAAGGTTGCACGTTTTCGTTTGGCAGGCAGATAGGCAGACATAGGAGAAAGCAAACCCAGCTTGATTGGAGGGCATGATAGTTGGTTTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 21.50% 0.08% 0.00% NA
All Indica  2759 71.10% 28.80% 0.11% 0.00% NA
All Japonica  1512 86.30% 13.70% 0.00% 0.00% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 65.00% 34.60% 0.34% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 53.90% 46.10% 0.00% 0.00% NA
Indica Intermediate  786 79.40% 20.50% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 63.30% 36.70% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818613813 T -> C LOC_Os08g30260-LOC_Os08g30270 intergenic_region ; MODIFIER silent_mutation Average:78.521; most accessible tissue: Callus, score: 92.707 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0818613813 T C -0.05 -0.04 -0.03 -0.1 -0.14 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818613813 NA 2.00E-06 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 NA 1.39E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 NA 2.16E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 1.27E-08 1.27E-08 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 NA 4.79E-07 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 9.03E-06 NA mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 NA 1.63E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 3.05E-06 NA mr1548 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 NA 6.70E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 NA 5.05E-08 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 NA 3.76E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 8.63E-06 8.62E-06 mr1873 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 NA 1.56E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 NA 1.27E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818613813 NA 4.99E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251