Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0818577556:

Variant ID: vg0818577556 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18577556
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCACCGCCTCTACCCACTCTTTCATGGGAGGAGGACCCACTCTACTTAGACCGAACCACGATCCGTGCCTTCGCCCGGAAGCTAAGCAGCCGTCCGTCCT[C/T]
GACTGGGCCCCGGCGCCACCCCCCGCCTGACACGGGGGACAACCCTGTCATTCGCTCTTAAATGAACGAAGACTTGTGGCGGTCCTTCTCACGTGGAGGG

Reverse complement sequence

CCCTCCACGTGAGAAGGACCGCCACAAGTCTTCGTTCATTTAAGAGCGAATGACAGGGTTGTCCCCCGTGTCAGGCGGGGGGTGGCGCCGGGGCCCAGTC[G/A]
AGGACGGACGGCTGCTTAGCTTCCGGGCGAAGGCACGGATCGTGGTTCGGTCTAAGTAGAGTGGGTCCTCCTCCCATGAAAGAGTGGGTAGAGGCGGTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.90% 7.00% 0.04% 0.00% NA
All Indica  2759 98.60% 1.40% 0.00% 0.00% NA
All Japonica  1512 88.30% 11.70% 0.00% 0.00% NA
Aus  269 61.00% 38.30% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.90% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 68.10% 31.90% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818577556 C -> T LOC_Os08g30220.1 upstream_gene_variant ; 1013.0bp to feature; MODIFIER silent_mutation Average:70.545; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 N N N N
vg0818577556 C -> T LOC_Os08g30230.1 upstream_gene_variant ; 4078.0bp to feature; MODIFIER silent_mutation Average:70.545; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 N N N N
vg0818577556 C -> T LOC_Os08g30240.1 upstream_gene_variant ; 4619.0bp to feature; MODIFIER silent_mutation Average:70.545; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 N N N N
vg0818577556 C -> T LOC_Os08g30220-LOC_Os08g30230 intergenic_region ; MODIFIER silent_mutation Average:70.545; most accessible tissue: Zhenshan97 flag leaf, score: 85.13 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0818577556 C T -0.01 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818577556 NA 4.82E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 2.41E-06 5.85E-08 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 9.41E-08 mr1046 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 9.21E-07 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 8.13E-08 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 4.23E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 2.44E-06 NA mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 1.97E-07 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 4.93E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 4.97E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 5.29E-07 1.42E-09 mr1266 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 4.43E-09 4.43E-09 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 2.07E-06 2.07E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 2.43E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 1.27E-10 mr1345 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 9.60E-06 1.63E-07 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 4.65E-06 mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 9.86E-06 NA mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 1.19E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 1.14E-08 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 9.99E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 3.91E-06 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 9.38E-06 3.24E-08 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 5.82E-06 6.75E-09 mr1427 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 2.37E-06 mr1427 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 3.01E-06 mr1472 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 1.60E-06 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 6.33E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 6.81E-09 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 1.40E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 1.41E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 2.86E-06 2.85E-06 mr1643 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 1.43E-06 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 5.36E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 2.51E-06 NA mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 1.34E-06 1.34E-06 mr1688 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 4.81E-12 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 3.92E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 8.69E-06 8.69E-06 mr1756 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 1.21E-07 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 1.81E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 1.72E-07 7.52E-12 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 3.70E-06 NA mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 3.05E-09 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 2.25E-06 2.25E-06 mr1873 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 6.90E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 3.07E-07 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 9.72E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818577556 NA 4.54E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251