\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818519417:

Variant ID: vg0818519417 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18519417
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CTTACGTAGCTATAGCACTTGAATCAATGCAGGGCAAAGAATGCATCTACGCCCCATACGCCTTTGAGTAAGTTTTCAGATCTAATATCTACTAGGAGTA[T/C]
ATACTTAATCGCGGCTCGACTAAGGATTTTTTTTTGTAGCGACCACTGGATTACTTTTCTTCTATATCCAAAGTATAACGAAGTTATAGTCTTGGATTCT

Reverse complement sequence

AGAATCCAAGACTATAACTTCGTTATACTTTGGATATAGAAGAAAAGTAATCCAGTGGTCGCTACAAAAAAAAATCCTTAGTCGAGCCGCGATTAAGTAT[A/G]
TACTCCTAGTAGATATTAGATCTGAAAACTTACTCAAAGGCGTATGGGGCGTAGATGCATTCTTTGCCCTGCATTGATTCAAGTGCTATAGCTACGTAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.10% 22.00% 0.53% 0.38% NA
All Indica  2759 68.50% 30.00% 0.87% 0.65% NA
All Japonica  1512 87.60% 12.40% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 69.60% 28.70% 1.68% 0.00% NA
Indica II  465 89.90% 9.70% 0.43% 0.00% NA
Indica III  913 57.80% 40.00% 0.44% 1.75% NA
Indica Intermediate  786 67.30% 31.40% 1.02% 0.25% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 68.30% 31.70% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818519417 T -> C LOC_Os08g30110.1 downstream_gene_variant ; 4743.0bp to feature; MODIFIER silent_mutation Average:30.204; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0818519417 T -> C LOC_Os08g30120.1 intron_variant ; MODIFIER silent_mutation Average:30.204; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0818519417 T -> DEL N N silent_mutation Average:30.204; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818519417 NA 5.44E-07 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 NA 2.83E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 3.07E-08 3.07E-08 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 2.47E-06 2.47E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 7.54E-06 2.46E-07 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 NA 2.97E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 NA 2.10E-06 mr1427 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 NA 1.63E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 NA 8.25E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 NA 3.75E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 NA 2.30E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 1.08E-06 1.08E-06 mr1756 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 NA 4.21E-06 mr1830 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 3.63E-06 3.63E-06 mr1335_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 NA 1.96E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818519417 NA 1.93E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251