Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0818421321:

Variant ID: vg0818421321 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 18421321
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

CACACTAACATTCTCCCCCTTGATCGTGAGGCTAAACTTATAAGTTTATTTCTCAATAAAATAGTATACCAAGACAAAAGATTACAGTGACCAATATAAA[A/G]
CATCACAGAATCCAGTGACTATAGCATACCATTATATTTTAAAATAAACTTCTTTAATCTTACGAGCTCTTTGAACTTATTACATTAGGCTTATACAAAC

Reverse complement sequence

GTTTGTATAAGCCTAATGTAATAAGTTCAAAGAGCTCGTAAGATTAAAGAAGTTTATTTTAAAATATAATGGTATGCTATAGTCACTGGATTCTGTGATG[T/C]
TTTATATTGGTCACTGTAATCTTTTGTCTTGGTATACTATTTTATTGAGAAATAAACTTATAAGTTTAGCCTCACGATCAAGGGGGAGAATGTTAGTGTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.80%	5.10%	3.28%	3.85%	NA
All Indica	2759	94.60%	1.10%	3.73%	0.58%	NA
All Japonica	1512	78.10%	10.10%	1.12%	10.65%	NA
Aus	269	71.00%	17.50%	11.52%	0.00%	NA
Indica I	595	95.60%	0.00%	4.37%	0.00%	NA
Indica II	465	95.70%	0.20%	1.72%	2.37%	NA
Indica III	913	94.40%	1.50%	4.05%	0.00%	NA
Indica Intermediate	786	93.50%	1.80%	4.07%	0.64%	NA
Temperate Japonica	767	96.50%	1.20%	0.39%	1.96%	NA
Tropical Japonica	504	52.00%	25.40%	0.79%	21.83%	NA
Japonica Intermediate	241	74.30%	6.60%	4.15%	14.94%	NA
VI/Aromatic	96	90.60%	5.20%	2.08%	2.08%	NA
Intermediate	90	87.80%	6.70%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818421321	A -> G	LOC_Os08g29980.1	upstream_gene_variant ; 1512.0bp to feature; MODIFIER	silent_mutation	Average:47.776; most accessible tissue: Minghui63 flower, score: 68.171	N	N	N	N
vg0818421321	A -> G	LOC_Os08g29990.1	downstream_gene_variant ; 254.0bp to feature; MODIFIER	silent_mutation	Average:47.776; most accessible tissue: Minghui63 flower, score: 68.171	N	N	N	N
vg0818421321	A -> G	LOC_Os08g29980-LOC_Os08g29990	intergenic_region ; MODIFIER	silent_mutation	Average:47.776; most accessible tissue: Minghui63 flower, score: 68.171	N	N	N	N
vg0818421321	A -> DEL	N	N	silent_mutation	Average:47.776; most accessible tissue: Minghui63 flower, score: 68.171	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818421321	3.27E-08	3.27E-08	mr1266	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818421321	2.81E-06	1.81E-08	mr1408	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818421321	NA	1.23E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818421321	1.59E-06	2.78E-07	mr1819	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818421321	NA	6.48E-07	mr1866	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818421321	1.64E-08	1.64E-08	mr1881	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251