Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818186823:

Variant ID: vg0818186823 (JBrowse)	Variation Type: INDEL
Chromosome: chr08	Position: 18186823
Reference Allele: A	Alternative Allele: C,ATCTACTC
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACGGAATGAGAAATATAACTACACCTCAATTATAAATATTAAATGTTCATAATAAATTTTAGCCAAACTCTCTAAAATGTAATAAGTTCATAATACTCC[A/C,ATCTACTC]
TCCATCTACTTTTGATAGTCATATTTCATCTTGGCACACAGACCAACGATAAGTGATTCTACTTATCATCCATTTAAACATGCTTCCATTTAAACATGCT

Reverse complement sequence

AGCATGTTTAAATGGAAGCATGTTTAAATGGATGATAAGTAGAATCACTTATCGTTGGTCTGTGTGCCAAGATGAAATATGACTATCAAAAGTAGATGGA[T/G,GAGTAGAT]
GGAGTATTATGAACTTATTACATTTTAGAGAGTTTGGCTAAAATTTATTATGAACATTTAATATTTATAATTGAGGTGTAGTTATATTTCTCATTCCGTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.90%	11.50%	1.18%	17.88%	ATCTACTC: 0.53%
All Indica	2759	65.10%	5.90%	1.63%	27.29%	ATCTACTC: 0.04%
All Japonica	1512	86.40%	9.70%	0.07%	3.84%	NA
Aus	269	3.30%	77.30%	2.60%	7.81%	ATCTACTC: 8.92%
Indica I	595	59.50%	1.30%	0.84%	38.32%	NA
Indica II	465	18.50%	4.50%	3.87%	73.12%	NA
Indica III	913	92.90%	5.90%	1.10%	0.11%	NA
Indica Intermediate	786	64.60%	10.30%	1.53%	23.41%	ATCTACTC: 0.13%
Temperate Japonica	767	98.30%	0.80%	0.00%	0.91%	NA
Tropical Japonica	504	67.50%	26.00%	0.20%	6.35%	NA
Japonica Intermediate	241	88.00%	4.10%	0.00%	7.88%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	64.40%	17.80%	3.33%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0818186823	A -> ATCTACTC	LOC_Os08g29650.1	upstream_gene_variant ; 2582.0bp to feature; MODIFIER	silent_mutation	Average:35.325; most accessible tissue: Callus, score: 91.611	N	N	N	N
vg0818186823	A -> ATCTACTC	LOC_Os08g29640.1	downstream_gene_variant ; 1346.0bp to feature; MODIFIER	silent_mutation	Average:35.325; most accessible tissue: Callus, score: 91.611	N	N	N	N
vg0818186823	A -> ATCTACTC	LOC_Os08g29640-LOC_Os08g29650	intergenic_region ; MODIFIER	silent_mutation	Average:35.325; most accessible tissue: Callus, score: 91.611	N	N	N	N
vg0818186823	A -> C	LOC_Os08g29650.1	upstream_gene_variant ; 2583.0bp to feature; MODIFIER	silent_mutation	Average:35.325; most accessible tissue: Callus, score: 91.611	N	N	N	N
vg0818186823	A -> C	LOC_Os08g29640.1	downstream_gene_variant ; 1345.0bp to feature; MODIFIER	silent_mutation	Average:35.325; most accessible tissue: Callus, score: 91.611	N	N	N	N
vg0818186823	A -> C	LOC_Os08g29640-LOC_Os08g29650	intergenic_region ; MODIFIER	silent_mutation	Average:35.325; most accessible tissue: Callus, score: 91.611	N	N	N	N
vg0818186823	A -> DEL	N	N	silent_mutation	Average:35.325; most accessible tissue: Callus, score: 91.611	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0818186823	NA	3.91E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	1.94E-15	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	1.68E-16	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	8.37E-07	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	1.07E-12	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	1.62E-08	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	5.82E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	4.65E-06	mr1349	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	2.99E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	1.26E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	4.37E-07	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	3.05E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	4.07E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	1.74E-06	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	1.97E-15	mr1696	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	5.15E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	1.87E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	7.72E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	8.00E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	7.17E-12	6.30E-14	mr1836	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	2.35E-06	3.26E-06	mr1852	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	NA	8.27E-09	mr1939	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	4.86E-06	NA	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823	1.03E-07	NA	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251