\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818186823:

Variant ID: vg0818186823 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 18186823
Reference Allele: AAlternative Allele: C,ATCTACTC
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACGGAATGAGAAATATAACTACACCTCAATTATAAATATTAAATGTTCATAATAAATTTTAGCCAAACTCTCTAAAATGTAATAAGTTCATAATACTCC[A/C,ATCTACTC]
TCCATCTACTTTTGATAGTCATATTTCATCTTGGCACACAGACCAACGATAAGTGATTCTACTTATCATCCATTTAAACATGCTTCCATTTAAACATGCT

Reverse complement sequence

AGCATGTTTAAATGGAAGCATGTTTAAATGGATGATAAGTAGAATCACTTATCGTTGGTCTGTGTGCCAAGATGAAATATGACTATCAAAAGTAGATGGA[T/G,GAGTAGAT]
GGAGTATTATGAACTTATTACATTTTAGAGAGTTTGGCTAAAATTTATTATGAACATTTAATATTTATAATTGAGGTGTAGTTATATTTCTCATTCCGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 11.50% 1.18% 17.88% ATCTACTC: 0.53%
All Indica  2759 65.10% 5.90% 1.63% 27.29% ATCTACTC: 0.04%
All Japonica  1512 86.40% 9.70% 0.07% 3.84% NA
Aus  269 3.30% 77.30% 2.60% 7.81% ATCTACTC: 8.92%
Indica I  595 59.50% 1.30% 0.84% 38.32% NA
Indica II  465 18.50% 4.50% 3.87% 73.12% NA
Indica III  913 92.90% 5.90% 1.10% 0.11% NA
Indica Intermediate  786 64.60% 10.30% 1.53% 23.41% ATCTACTC: 0.13%
Temperate Japonica  767 98.30% 0.80% 0.00% 0.91% NA
Tropical Japonica  504 67.50% 26.00% 0.20% 6.35% NA
Japonica Intermediate  241 88.00% 4.10% 0.00% 7.88% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 64.40% 17.80% 3.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818186823 A -> ATCTACTC LOC_Os08g29650.1 upstream_gene_variant ; 2582.0bp to feature; MODIFIER silent_mutation Average:35.325; most accessible tissue: Callus, score: 91.611 N N N N
vg0818186823 A -> ATCTACTC LOC_Os08g29640.1 downstream_gene_variant ; 1346.0bp to feature; MODIFIER silent_mutation Average:35.325; most accessible tissue: Callus, score: 91.611 N N N N
vg0818186823 A -> ATCTACTC LOC_Os08g29640-LOC_Os08g29650 intergenic_region ; MODIFIER silent_mutation Average:35.325; most accessible tissue: Callus, score: 91.611 N N N N
vg0818186823 A -> C LOC_Os08g29650.1 upstream_gene_variant ; 2583.0bp to feature; MODIFIER silent_mutation Average:35.325; most accessible tissue: Callus, score: 91.611 N N N N
vg0818186823 A -> C LOC_Os08g29640.1 downstream_gene_variant ; 1345.0bp to feature; MODIFIER silent_mutation Average:35.325; most accessible tissue: Callus, score: 91.611 N N N N
vg0818186823 A -> C LOC_Os08g29640-LOC_Os08g29650 intergenic_region ; MODIFIER silent_mutation Average:35.325; most accessible tissue: Callus, score: 91.611 N N N N
vg0818186823 A -> DEL N N silent_mutation Average:35.325; most accessible tissue: Callus, score: 91.611 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818186823 NA 3.91E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 1.94E-15 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 1.68E-16 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 8.37E-07 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 1.07E-12 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 1.62E-08 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 5.82E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 4.65E-06 mr1349 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 2.99E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 1.26E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 4.37E-07 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 3.05E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 4.07E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 1.74E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 1.97E-15 mr1696 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 5.15E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 1.87E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 7.72E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 8.00E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 7.17E-12 6.30E-14 mr1836 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 2.35E-06 3.26E-06 mr1852 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 NA 8.27E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 4.86E-06 NA mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818186823 1.03E-07 NA mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251