\
| Variant ID: vg0818043217 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 18043217 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 101. )
CGTTCCTACCAAGCTTCCTGAATGTAGCATAAGGCATCAAATTCACCGCGGCCCCACCATCGACCATCATCTTAGACATCGGCTTCCCATTGACGTAGCC[G/A]
TTTATATACAATGGTTTAAGATGCCGATTCTCTGTCCCCTCGGGTTTATCGAATACTGCCTGCTCTGGTGACGGAACCAACTTAGCCGATTCCTCTTCCA
TGGAAGAGGAATCGGCTAAGTTGGTTCCGTCACCAGAGCAGGCAGTATTCGATAAACCCGAGGGGACAGAGAATCGGCATCTTAAACCATTGTATATAAA[C/T]
GGCTACGTCAATGGGAAGCCGATGTCTAAGATGATGGTCGATGGTGGGGCCGCGGTGAATTTGATGCCTTATGCTACATTCAGGAAGCTTGGTAGGAACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.20% | 41.60% | 2.56% | 4.61% | NA |
| All Indica | 2759 | 28.00% | 68.90% | 2.32% | 0.76% | NA |
| All Japonica | 1512 | 85.60% | 1.60% | 0.40% | 12.43% | NA |
| Aus | 269 | 81.80% | 1.50% | 16.36% | 0.37% | NA |
| Indica I | 595 | 37.80% | 59.50% | 2.69% | 0.00% | NA |
| Indica II | 465 | 8.60% | 90.10% | 1.29% | 0.00% | NA |
| Indica III | 913 | 27.30% | 69.90% | 0.99% | 1.86% | NA |
| Indica Intermediate | 786 | 32.80% | 62.50% | 4.20% | 0.51% | NA |
| Temperate Japonica | 767 | 98.70% | 1.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 62.90% | 2.00% | 0.60% | 34.52% | NA |
| Japonica Intermediate | 241 | 91.30% | 2.50% | 1.24% | 4.98% | NA |
| VI/Aromatic | 96 | 91.70% | 3.10% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 52.20% | 36.70% | 6.67% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0818043217 | G -> A | LOC_Os08g29430.1 | synonymous_variant ; p.Asn737Asn; LOW | synonymous_codon | Average:43.166; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| vg0818043217 | G -> DEL | LOC_Os08g29430.1 | N | frameshift_variant | Average:43.166; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0818043217 | NA | 1.84E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818043217 | NA | 3.96E-09 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818043217 | 7.51E-06 | 5.52E-10 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818043217 | NA | 3.03E-09 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818043217 | NA | 5.91E-10 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818043217 | NA | 6.23E-10 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818043217 | NA | 2.40E-07 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818043217 | 2.84E-06 | 3.06E-10 | mr1995 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818043217 | 8.96E-06 | 1.29E-09 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818043217 | NA | 4.93E-06 | mr1726_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818043217 | NA | 7.49E-06 | mr1892_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0818043217 | NA | 2.46E-07 | mr1950_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |