Variant ID: vg0818034083 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 18034083 |
Reference Allele: C | Alternative Allele: A |
Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CACCGTGAACCCGAGCCCGCTGACGCAATAATCCTCTTTTCCTTTTCAAAAATAATTCATTATTGCGTCATAATTCAATTAAAATCTATATAAATGATTT[C/A]
ATCCGATTTAATCTTTGAAAATTCATAACTAATTCATCTTAGCTTGGATTTAGTTGGTTCAAGTCTCTAAATTTTTCTAAAATTGAGATCTACATGTTAA
TTAACATGTAGATCTCAATTTTAGAAAAATTTAGAGACTTGAACCAACTAAATCCAAGCTAAGATGAATTAGTTATGAATTTTCAAAGATTAAATCGGAT[G/T]
AAATCATTTATATAGATTTTAATTGAATTATGACGCAATAATGAATTATTTTTGAAAAGGAAAAGAGGATTATTGCGTCAGCGGGCTCGGGTTCACGGTG
Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 68.90% | 26.70% | 3.17% | 1.18% | NA |
All Indica | 2759 | 93.40% | 2.40% | 3.37% | 0.83% | NA |
All Japonica | 1512 | 24.70% | 71.10% | 2.12% | 2.12% | NA |
Aus | 269 | 89.20% | 3.00% | 7.81% | 0.00% | NA |
Indica I | 595 | 89.40% | 3.70% | 6.55% | 0.34% | NA |
Indica II | 465 | 93.10% | 1.10% | 3.23% | 2.58% | NA |
Indica III | 913 | 97.00% | 1.50% | 1.10% | 0.33% | NA |
Indica Intermediate | 786 | 92.40% | 3.20% | 3.69% | 0.76% | NA |
Temperate Japonica | 767 | 3.50% | 96.30% | 0.00% | 0.13% | NA |
Tropical Japonica | 504 | 56.20% | 31.90% | 5.95% | 5.95% | NA |
Japonica Intermediate | 241 | 26.10% | 72.60% | 0.83% | 0.41% | NA |
VI/Aromatic | 96 | 11.50% | 85.40% | 3.12% | 0.00% | NA |
Intermediate | 90 | 62.20% | 35.60% | 1.11% | 1.11% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0818034083 | C -> A | LOC_Os08g29400.1 | downstream_gene_variant ; 2698.0bp to feature; MODIFIER | silent_mutation | Average:32.378; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
vg0818034083 | C -> A | LOC_Os08g29420.1 | downstream_gene_variant ; 2198.0bp to feature; MODIFIER | silent_mutation | Average:32.378; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
vg0818034083 | C -> A | LOC_Os08g29400.2 | downstream_gene_variant ; 2698.0bp to feature; MODIFIER | silent_mutation | Average:32.378; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
vg0818034083 | C -> A | LOC_Os08g29400-LOC_Os08g29420 | intergenic_region ; MODIFIER | silent_mutation | Average:32.378; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
vg0818034083 | C -> DEL | N | N | silent_mutation | Average:32.378; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0818034083 | NA | 6.29E-06 | mr1177 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818034083 | 6.89E-06 | NA | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818034083 | NA | 8.44E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818034083 | NA | 3.18E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818034083 | NA | 1.04E-12 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818034083 | NA | 1.94E-06 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818034083 | NA | 4.12E-23 | mr1304_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818034083 | NA | 5.84E-09 | mr1401_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818034083 | 3.73E-06 | NA | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818034083 | NA | 1.30E-11 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818034083 | NA | 4.90E-11 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818034083 | NA | 2.27E-09 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0818034083 | NA | 1.17E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |