\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0818034083:

Variant ID: vg0818034083 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 18034083
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCGTGAACCCGAGCCCGCTGACGCAATAATCCTCTTTTCCTTTTCAAAAATAATTCATTATTGCGTCATAATTCAATTAAAATCTATATAAATGATTT[C/A]
ATCCGATTTAATCTTTGAAAATTCATAACTAATTCATCTTAGCTTGGATTTAGTTGGTTCAAGTCTCTAAATTTTTCTAAAATTGAGATCTACATGTTAA

Reverse complement sequence

TTAACATGTAGATCTCAATTTTAGAAAAATTTAGAGACTTGAACCAACTAAATCCAAGCTAAGATGAATTAGTTATGAATTTTCAAAGATTAAATCGGAT[G/T]
AAATCATTTATATAGATTTTAATTGAATTATGACGCAATAATGAATTATTTTTGAAAAGGAAAAGAGGATTATTGCGTCAGCGGGCTCGGGTTCACGGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 26.70% 3.17% 1.18% NA
All Indica  2759 93.40% 2.40% 3.37% 0.83% NA
All Japonica  1512 24.70% 71.10% 2.12% 2.12% NA
Aus  269 89.20% 3.00% 7.81% 0.00% NA
Indica I  595 89.40% 3.70% 6.55% 0.34% NA
Indica II  465 93.10% 1.10% 3.23% 2.58% NA
Indica III  913 97.00% 1.50% 1.10% 0.33% NA
Indica Intermediate  786 92.40% 3.20% 3.69% 0.76% NA
Temperate Japonica  767 3.50% 96.30% 0.00% 0.13% NA
Tropical Japonica  504 56.20% 31.90% 5.95% 5.95% NA
Japonica Intermediate  241 26.10% 72.60% 0.83% 0.41% NA
VI/Aromatic  96 11.50% 85.40% 3.12% 0.00% NA
Intermediate  90 62.20% 35.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0818034083 C -> A LOC_Os08g29400.1 downstream_gene_variant ; 2698.0bp to feature; MODIFIER silent_mutation Average:32.378; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N
vg0818034083 C -> A LOC_Os08g29420.1 downstream_gene_variant ; 2198.0bp to feature; MODIFIER silent_mutation Average:32.378; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N
vg0818034083 C -> A LOC_Os08g29400.2 downstream_gene_variant ; 2698.0bp to feature; MODIFIER silent_mutation Average:32.378; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N
vg0818034083 C -> A LOC_Os08g29400-LOC_Os08g29420 intergenic_region ; MODIFIER silent_mutation Average:32.378; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N
vg0818034083 C -> DEL N N silent_mutation Average:32.378; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0818034083 NA 6.29E-06 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818034083 6.89E-06 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818034083 NA 8.44E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818034083 NA 3.18E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818034083 NA 1.04E-12 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818034083 NA 1.94E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818034083 NA 4.12E-23 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818034083 NA 5.84E-09 mr1401_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818034083 3.73E-06 NA mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818034083 NA 1.30E-11 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818034083 NA 4.90E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818034083 NA 2.27E-09 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0818034083 NA 1.17E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251