\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817698022:

Variant ID: vg0817698022 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17698022
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGGATACTGATATTAACAAGTTGCAACTTTTTTTCCGAAAGCCGATCTCTAAAGAACTCCAAGGTTAAGCGTGCTTGGCCTGGAGCAATTTGGGATGGG[T/C]
GACCGACTCGGAAATTCTTCCCGGGTGCGCATGAATGAGGACAAAGTGTGCAGAAAAGACTTGTGTTGGTCTGTGGGGGCAGTCTATGACCTATGAAAGC

Reverse complement sequence

GCTTTCATAGGTCATAGACTGCCCCCACAGACCAACACAAGTCTTTTCTGCACACTTTGTCCTCATTCATGCGCACCCGGGAAGAATTTCCGAGTCGGTC[A/G]
CCCATCCCAAATTGCTCCAGGCCAAGCACGCTTAACCTTGGAGTTCTTTAGAGATCGGCTTTCGGAAAAAAAGTTGCAACTTGTTAATATCAGTATCCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 5.60% 0.87% 0.51% NA
All Indica  2759 96.60% 2.40% 0.83% 0.18% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 15.60% 71.40% 5.95% 7.06% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 95.30% 1.50% 3.23% 0.00% NA
Indica III  913 97.20% 2.60% 0.11% 0.11% NA
Indica Intermediate  786 94.40% 4.20% 0.89% 0.51% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817698022 T -> C LOC_Os08g28940.1 upstream_gene_variant ; 1102.0bp to feature; MODIFIER silent_mutation Average:69.564; most accessible tissue: Minghui63 flag leaf, score: 85.5 N N N N
vg0817698022 T -> C LOC_Os08g28930.1 downstream_gene_variant ; 4365.0bp to feature; MODIFIER silent_mutation Average:69.564; most accessible tissue: Minghui63 flag leaf, score: 85.5 N N N N
vg0817698022 T -> C LOC_Os08g28930-LOC_Os08g28940 intergenic_region ; MODIFIER silent_mutation Average:69.564; most accessible tissue: Minghui63 flag leaf, score: 85.5 N N N N
vg0817698022 T -> DEL N N silent_mutation Average:69.564; most accessible tissue: Minghui63 flag leaf, score: 85.5 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817698022 NA 1.69E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 1.98E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 3.60E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 7.54E-06 mr1349 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 9.81E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 2.50E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 1.83E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 9.54E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 3.57E-07 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 1.30E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 1.02E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 8.53E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 1.60E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 4.58E-09 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 5.46E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 6.15E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 7.15E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 NA 4.23E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 2.82E-06 5.93E-07 mr1915_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022 8.66E-06 NA mr1930_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251