Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817698022:

Variant ID: vg0817698022 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17698022
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGGATACTGATATTAACAAGTTGCAACTTTTTTTCCGAAAGCCGATCTCTAAAGAACTCCAAGGTTAAGCGTGCTTGGCCTGGAGCAATTTGGGATGGG[T/C]
GACCGACTCGGAAATTCTTCCCGGGTGCGCATGAATGAGGACAAAGTGTGCAGAAAAGACTTGTGTTGGTCTGTGGGGGCAGTCTATGACCTATGAAAGC

Reverse complement sequence

GCTTTCATAGGTCATAGACTGCCCCCACAGACCAACACAAGTCTTTTCTGCACACTTTGTCCTCATTCATGCGCACCCGGGAAGAATTTCCGAGTCGGTC[A/G]
CCCATCCCAAATTGCTCCAGGCCAAGCACGCTTAACCTTGGAGTTCTTTAGAGATCGGCTTTCGGAAAAAAAGTTGCAACTTGTTAATATCAGTATCCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	5.60%	0.87%	0.51%	NA
All Indica	2759	96.60%	2.40%	0.83%	0.18%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	15.60%	71.40%	5.95%	7.06%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	95.30%	1.50%	3.23%	0.00%	NA
Indica III	913	97.20%	2.60%	0.11%	0.11%	NA
Indica Intermediate	786	94.40%	4.20%	0.89%	0.51%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817698022	T -> C	LOC_Os08g28940.1	upstream_gene_variant ; 1102.0bp to feature; MODIFIER	silent_mutation	Average:69.564; most accessible tissue: Minghui63 flag leaf, score: 85.5	N	N	N	N
vg0817698022	T -> C	LOC_Os08g28930.1	downstream_gene_variant ; 4365.0bp to feature; MODIFIER	silent_mutation	Average:69.564; most accessible tissue: Minghui63 flag leaf, score: 85.5	N	N	N	N
vg0817698022	T -> C	LOC_Os08g28930-LOC_Os08g28940	intergenic_region ; MODIFIER	silent_mutation	Average:69.564; most accessible tissue: Minghui63 flag leaf, score: 85.5	N	N	N	N
vg0817698022	T -> DEL	N	N	silent_mutation	Average:69.564; most accessible tissue: Minghui63 flag leaf, score: 85.5	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817698022	NA	1.69E-06	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	1.98E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	3.60E-06	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	7.54E-06	mr1349	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	9.81E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	2.50E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	1.83E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	9.54E-08	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	3.57E-07	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	1.30E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	1.02E-06	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	8.53E-06	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	1.60E-06	mr1787	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	4.58E-09	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	5.46E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	6.15E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	7.15E-06	mr1597_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	NA	4.23E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	2.82E-06	5.93E-07	mr1915_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817698022	8.66E-06	NA	mr1930_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251